1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Irina-Kira [14]
3 years ago
10

What atoms are found in all carbohydrates

Biology
1 answer:
amm18123 years ago
8 0
Carbon,hydrogen, and oxygen
You might be interested in
What are some ways that healthcaer professionals can decrease the risk of drug abuse and addiction?
Goryan [66]
They can confiscate the abusive drug the person if using, or admit the person to rehab, or simply apply them for therapy. They can substitute the drug for something else like say it was a cigarette, you could instead use cigarette shaped candy’s. There are quite a bit of ways to help but those are just a few.
3 0
3 years ago
How was Aristotle's classification system similar to the modern one
Art [367]

Aristotle classification

He classified plant and animals into two separate kingdoms

Modern Classification

In this system also, there were two separate kingdoms for plant and animals

7 0
3 years ago
Read 2 more answers
We have looked at the cloning experiments involved in producing Snuppy. Describe the specific technique that was used and how th
Sergio039 [100]

Answer:

Cloning may be defined as the process by which the genetically identified individual of the organism can be created artifically or naturally. Aseual reproduction results in the formation of clone.

The microsatellite analysis is used to prove that snuppy is a clone. Microsatellites are the highly variable DNA sequences repeats that has variable loci and considered at population level. The two alleles are possible for the one microsatellite locus. After comparing the alleles it has been found that snuppy has exactly the same genetic material as the surrogate mother, afghan. This completely determines that snuppy is a clone of afgan.

7 0
3 years ago
A biotic or an abiotic resource in the environment that causes population size decrease is
Nadusha1986 [10]


Water! (abiotic)

If water runs out then everything dies! :)

Thanks for the opportunity to answer your question and I hope this help! :)

8 0
3 years ago
Which is an advantage of a natural-gas-burning power plant over an oil-
finlep [7]

Answer:

C. It uses a renewable resources

7 0
3 years ago
Other questions:
  • How does the addition or removal of heat change the state of an object?
    5·1 answer
  • Which of the following is the best example of an abiotic factor limiting population size?
    15·1 answer
  • What is not contained in our blood?
    7·2 answers
  • I need help with this problem​
    10·1 answer
  • Cyclostomata are fish made of
    12·2 answers
  • What is basal metabolic rate?
    11·1 answer
  • What do bacteria have in common with the cells of other living organisms?
    14·2 answers
  • When in U.S, history did pollution start to become an issue? Explain why pollution was not an issue prior to this time period.
    13·1 answer
  • 18. Why does DNA Replication have to happen at this stage of the cell<br> cycle? *
    12·1 answer
  • The tRNA for GUCAUCGAUCGAUCGGAUGCC
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!