18. Why does DNA Replication have to happen at this stage of the cell cycle? *

Biology

1 answer:

lorasvet [3.4K]3 years ago

4 0

Answer:

Because DNA is duplicated during interphase before the cell undergoes mitosis, the amount of DNA in the original parent cell and the daughter cells are exactly the same. Both genetics, as well as external factors, can play a role in the development of cancer.

Explanation:

HOPE IT HELPSSS

You might be interested in

Does the sand at night have less kinetic energy than the sand on a sunny day?

STatiana [176]

Because the sun heats up the sand causing the atoms to move much faster than at night

6 0

3 years ago

Which would be true of sexual reproduction?

pshichka [43]

Answer:

c increases genetic diversity

Explanation:

8 0

3 years ago

Read 2 more answers

BLAST (Basic Local Alignment Search Tool) is a powerful tool for comparing unknown sequences to sequences in online databases. I

storchak [24]

Answer:

This is a well conserved sequence.

Explanation: BLAST a way to match or align a string of DNA or protein sequence to those that are already in a database. The way that this is done is by using statistics carefully to calculate the significance of the match. The BLAST result will produce 4 categories Max Score, Total Score, Query cover, E-Value Percent Identity. The Accession will indicate database of the sequence. In this Sequence: AAGACCCGCCGGGAGGCAGAGGACCTGCAGGGTGAGCCAACCGCCCATTGCT covers over 98.08% identity to the coding sequence (cds) of insulin. This sequence appears to be in a conserved region for many of the listed organism. This suggest that this part of the coding sequence for this protein is highly conserved

3 0

3 years ago

Why is it important that tissues are composed of specialized cells?

KatRina [158]

Cell specialization allows new cells to develop into a range of different tissues, all of which work together to make living organisms function as a whole. The process of cell specialization exactly how cells develop into their diverse forms is complex.

6 0

3 years ago

If an organism has a total diploid number of 60 chromosomes, how many chromosomes will each daughter cell have after mitosis? Af

g100num [7]

Answer:

If an organism has a total diploid number of 60 chromosomes, same number of chromosomes i. e. 60 are present in each daughter cell after mitosis while half number of chromosome i. e. 30 are present in each daughter cell after meiosis.

Explanation: Mitosis is a type of cell division in which a single cell is divided into two daughter cells having double number of chromosomes, while meiosis is a type of cell division in which a single cell is divided into four daughter cells having half number of chromosome.

5 0

3 years ago