1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Helga [31]
3 years ago
6

What is the function of DNA polymerase?

Biology
1 answer:
Rus_ich [418]3 years ago
4 0

Answer:

Adding base pairs

Explanation:

If it help follow me on brainly please

You might be interested in
12. Removing an organism from an ecosystem will have which of the following affects? Select all that apply.
lutik1710 [3]

Answer:

B and D

Explanation:

Biodiversity comes from having multiple types of organisms. This also allows different organisms to eat and create nutrients that is needed by all other organisms in the ecosystem.

4 0
3 years ago
The eukaryotes, bacteria, and archaea that live in and on the human body are called normal microbiota. When they were originally
Alla [95]

Answer:

The eukaryotes, bacteria, and archaea that live in and on the human body are called normal microbiota. When they were originally discovered, scientists thought that the relationship between these organisms was parasitic because they thought that the organisms benefit from living on the host but did not help the host. In recent years, researchers have determined that most of our resident microbes derive and give benefit to the host. This makes the relationship between host and microbe one of mutualism. Pathogenic, on the other hand, are microbes that cause diseases.

5 0
4 years ago
If the two oligonucleotides are allowed to anneal and the DNA polymerase and all substrates (4 dNTPs, etc.) are added to the mix
Lorico [155]

Answer:

d. T

Explanation:

For a given DNA sequence, the array is represented as:

5'ATCCTGGACACTGTACCATCGGTACCAATCACAGGTCCTTACAGT 3'

And the premier; 5' GGACCTGTGA 3' attaches to the complementary base on the DNA sequence.

i.e.

5'ATCCTGGACACTGTACCATCGGTACCAATCACAGGTCCTTACAGT 3'

*AGTGTCCAGG

Thus, the first nucleotide that will be incorporated into the DNA will be T

5 0
3 years ago
Opinion? what do you think?
ivann1987 [24]

Answer:

oh wow u are very prettttttttty

6 0
3 years ago
Read 2 more answers
Using the diagram, which of the structures is the oldest?<br><br> H<br> F<br> M<br> B
Anna35 [415]
I would say B so yea...hope ur day doing well
6 0
3 years ago
Other questions:
  • There are ______ sperm in the typical male ejaculation.
    15·2 answers
  • What is Nuc short for?
    11·1 answer
  • ________ form when a source of energy causes a medium to vibrate
    9·1 answer
  • The earths energy budget
    12·2 answers
  • help?? im done with everything just Explain how losing one part of this food chain will unbalance the whole ecosystem.
    12·1 answer
  • When the genotype consists of a dominant and a recessive allele, the phenotype will be like _________ alllele.
    11·2 answers
  • Sexual reproduction helps to increase _<br> The advantage of asexual reproduction is _
    15·1 answer
  • How to be a grown up
    9·1 answer
  • Name this organism? <br><br>Is this organism prokaryotic or eukaryotic?
    12·1 answer
  • In 1860, a scientist named Gregor Mendel used pea plants to determine the dominance of certain traits. In one of his experiments
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!