Answer:
Shape
Explanation:
The structure of a DNA sequence determines the function of a protein by it's shape. The shape of a protein is determined by the sequence of the amino acids which is also the primary structures. And then the sequence of amino acids are determined by the sequence of nucleotides in the genes, which encodes it.
Hope this helped!
Have a supercalifragilisticexpialidocious day!
The endocrine system releases hormones into the bloodstream, most of which are released by the pituitary gland
i believe that to be correct
Answer:
First, you must know what the stop codons are: UAA, UAG, and UGA
Whenever this sequence is read, it signals for an end in transcription and amino acids will stop being formed
Thus, 5′−GGCCCUUUUAGGGCCUUUUU−3′ contains a cue for transcription termination as it will stop after the codon "UAG"
Explanation:
Species are going extinct before we know it because species are constantly adapting to their environment leading them to then evolve with different traits more suitable for their environment, thus creating species out of the ones that previously existed.
