1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Irina18 [472]
4 years ago
6

people have been warned about he dangers of excessive exposure to radiation during certain mexical procedures.The most likely re

ason for this warning is that radiation exposure might
Biology
1 answer:
egoroff_w [7]4 years ago
8 0
Cause early death at a later age.
Brainliest pls!
You might be interested in
"breeding two individuals with different traits." (it is 15 across)
ale4655 [162]

Answer:

Hybridization

Explanation:

I think this is it. Hope this helps you :)

7 0
3 years ago
Human activities, such as the burning of fossil fuels, result in air pollution. what could be an outcome if the amount of smoke
fomenos
People would have made it easier to destroy the world by releasing pollutants which can destroy the ozone layer and cause global warming. <span>The sudden increase in temperature would cause an imbalance in the ecosystem. In effect, this would cause declined population of animals and a disturbance of plant growth. People would also have an increasing problem in lung related diseases.</span>
6 0
3 years ago
Read 2 more answers
Which of the following are part of the ocean's ecosystems?
aalyn [17]
<span>D) intertidal zones, deep sea vents and salt marshes</span>
6 0
3 years ago
Read 2 more answers
.Specific processes must take place within the cell for protein synthesis to occur. The processes that take place within a cell
natta225 [31]

Answer:

An mRNA template is used to create an amino acid chain.

Explanation:

Transcription is the first step in the protein synthesis process. Translation is the second.

Overall, the central dogma of biology is DNA->RNA->protein.

Transcription is that first step, DNA to RNA, and translation is RNA to protein: think of it like nucleic acids can just be transcribed, but nucleic acid to protein is like a whole different language, so it has to be translated. So the correct answer here is that mRNA is used to make amino acid chain (aka protein), which happens only in translation.

4 0
4 years ago
What is the mRNA in TACCGGATGCCAGATCAAATC?
Softa [21]

Answer:

AUGGCCUACGGUCUAGUUUAG

3 0
3 years ago
Other questions:
  • Three cells undergo meiosis. How many haploid cells are produced?. A) 3. B) 6. C) 9. D) 12.
    13·2 answers
  • During the early stages of meiosis, two chromosomes in a homologous pair may exchange segments, producing genetic variation in s
    5·2 answers
  • Can someone help me please
    6·1 answer
  • Homology and homoplasy produce similar traits. What is the key difference?
    15·1 answer
  • Mendel developed pure lines of peas for his experiments because he wanted them to be _____.
    12·1 answer
  • A havelock can be found on what part of a soldier's body?
    6·1 answer
  • Which statements best describe shared characteristics? Select two options.
    8·2 answers
  • What are climate zones?
    15·1 answer
  • Which two classification levels do we use in binomial nomenclature?
    12·1 answer
  • In response to a threat, we perspire, breathe more quickly, get goose bumps, and feel nauseous. These responses are controlled b
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!