1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
aliya0001 [1]
3 years ago
6

Look at the image of a plant. Which tropism is best illustrated?

Biology
1 answer:
oksano4ka [1.4K]3 years ago
6 0
I can’t see the image!! Sorry!!
You might be interested in
HIV replication requires conversion of the genomic RNA present in the infecting virus to a double stranded DNA that integrates i
xeze [42]

Answer:

AZT inhibits reverse transcriptase enzyme.

Explanation:

AZT inhibits reverse transcriptase enzyme that is used by the virus to make a DNA copy of its RNA. This Azidothymidine prevent reverse transcriptase enzyme from doing its function properly. Due to absence of this enzyme, the HIV virus is unable to make copies of its DNA and this Azidothymidine stops the life cycle of the virus and slows the growth of AIDS disease so that's why this drug was considered effective against HIV virus and used in the treatment of AIDS disease.

8 0
3 years ago
Explain how the nucleus Observed in cheek cell​
erastovalidia [21]

Answer:

The nucleus at the central part of the cheek cell contains DNA. When a drop of methylene blue is introduced, the nucleus is stained, which makes it stand out and be clearly seen under the microscope.

Copied

7 0
3 years ago
Read 2 more answers
What is the most likely function of this structure?
Diano4ka-milaya [45]
A to move around is the answer
3 0
3 years ago
Anyone wanna be my friend and answer a question can ocean waves freeze
lesantik [10]

Answer:

yes ;P

Explanation:

yw

6 0
3 years ago
Read 2 more answers
A scientist who studies the variety of animals in the environment
Alenkinab [10]

Answer:

Zoologist

Explanation:

A person who specializes in the study of animals is called a zoologist. Zoologists who study certain kinds of animals have their own names.A botanist is a scientist who studies or experiments with plants. These plants may include a range of organisms, including flowers, trees and algae. Botanists are a type of biologist. Botanists study all forms of plant life.

6 0
3 years ago
Other questions:
  • When an object is burning, two atoms of oxygen (in the air) combine with one atom of carbon (from the
    9·1 answer
  • A compound synthesized by bacteria or fungi that destroys or inhibits the growth of other microbes is a/an:__________.
    6·2 answers
  • What point do all graphs of the form y = a* where a 0 have in common?
    12·1 answer
  • List the nitrogen bases that would form the complementary strand: TTCTACCCTACATAGACTCAT
    14·1 answer
  • How is colorblindness inherited? Explain
    10·1 answer
  • (iii) Write one function of each Microbe used in clean technology:
    11·1 answer
  • Pollutants can enter a body of water at a specific, identifiable location.
    8·1 answer
  • explain why eating down a food chain," vegetables instead of meat for example, is more energy efficient
    14·1 answer
  • Clay in soils represents a trade-off in nutrient availability, such that ________.
    6·1 answer
  • When water changes state from a gas to a liquid, the ____________ of the water remains the same.
    6·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!