The density of the water causes pressure, which causes water to move.
Autotrophs are organism that is a Heterotroph.
The answer is Ser-Arg-Ala-Val-Gly-STOP
It is known that three nucleotide bases on mRNA are called
codon and that each codon codes for the specific amino acid. According to the
genetic code chart, the following mRNA sequence will code for the following
amino acid sequence:
mRNA sequence: <span>UCU CGA GCC GUU GGG UGA</span>
Amino acid sequence: Ser Arg Ala Val Gly STOP
Answer:
ierieieieeoeoeieiririiekkek
Answer:
(3')CGCGTTATAAAGAGTTTTATAACGCG(5')
Explanation:
<em>The complementary strand is
:</em>
(5')GCGCAATATTTTGAGAAATATTGCGC(3')
<em>The base sequence of the complimentary strand is:</em>
(3')CGCGTTATAAAGAGTTTTATAACGCG(5')
Because this sequence is self-complementary, the individual strands can form hairpin structures. The two strands together may also form a cruciform.
Hairpin structures can be formed by sequences with inverted repeats through two major mechanisms.
- DNA is single stranded in cellular processes such as; during replication on the template for lagging-strand synthesis, bacterial conjugation, natural transformation, and infection by some viruses. Single stranded DNA can fold into secondary structures recognized by proteins, involved in site-specific recombination, transcription, and replication.
- Hairpins can also be formed from double-stranded DNA as a cruciform. A cruciform is a structure consisting of two hairpins extruding through intrastrand base pairing from a palindromic or inverted-reverse sequence.
