Because his principles of geology explained how Earth was shaped by the same processes, earthquakes, volcanoes, etc, as they are today. Darwin used this principle to hypothesize his theory of evolution that species must have also changed over time by the same processes like fitness.

5 0

4 years ago

Scientists have changed the DNA of a type of cabbage so that it contains a tiny amount of poison from a scorpion’s tail. The poi

Alja [10]

I think the correct answer from the choices listed above is option C. This certain occurrence is an example of genetic engineering. In this case, the genetic makeup of the cabbage is being altered in order to improvements to the plant for its survival. Hope this answers the question.

5 0

3 years ago

Read 2 more answers

Assume that one backbone of a DNA molecule has the sequence given below. A-T-G-G-G-G-G-C-G-A-T-A-T-T-T-T-A-T-C-C-G-A-C-G For thi

Likurg_2 [28]

Answer:

DNA: ATGGGGGCGATATTTTATCCGACG

RNA: AUGGGGGCGAUAUUUUAUCCGACG

Protein: MGAIFYPT

Explanation:

Transcription is a genetic process by which the information in a strand of DNA is copied into RNA, typically a messenger RNA (mRNA) sequence which is subsequently used to create a protein by the process of translation. During translation, each triplet of nucleotides or 'codon' corresponds to a specific amino acid. For example, AUG is a codon that codes for methionine (M) and also acts as an initiation codon at the beginning of the nascent polypeptide chain.

7 0

3 years ago