1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Ostrovityanka [42]
3 years ago
7

By comparing the molecular structure of catechol and hydroquinone, determine what actually influences the specificity of catecho

l oxidase?

Biology
1 answer:
kodGreya [7K]3 years ago
8 0
Attached is an image of a <span>catechol and a hydroquinone.
The specifity of the catechol oxidase is given by the spatial position of the OH groups. Most of the enzymes have an active site that's specific to spatial conformities of the substrate. If the substrate is not in such spatial conformation it may not be recognised be the enzyme.</span>

You might be interested in
Groups of cells that are similar in structure and perform a common or related function form a(n) ________.
ankoles [38]

Answer: tissue

Explanation:

All living organisms are made up of one or more cells. For example, unicellular organisms, such as amoebas, are made up of only one cell. Multicellular organisms, such as human beings, are made up of many cells. And cells in complex multicellular organisms  are organized into tissues,  which refers to similar groups of cells that work together on a specific task.

7 0
3 years ago
Can someone help me??
Ilya [14]

Answer:

i would try B

Explanation:

sorry if im wrong

6 0
3 years ago
Can you share some interesting information about HIV?​
Fed [463]
HIV CAME FROM CHIMPS
3 0
3 years ago
Read 2 more answers
A model of a DNA molecule is shown below. The arrow indicates...
matrenka [14]

Answer:

The hydrogen bond between complementary nucleotides (C)

Explanation:

Hope this helped

4 0
4 years ago
Read 2 more answers
Plants move water from the roots of the plant to the leaves through transpiration. As water evaporates from the leaf, cohesion p
adoni [48]

Answer:

Stomata are the organs present on the stem and leaves of the plant and help in the gaseous exchange and evaporating water present in the aerial parts of the plant. Mainly leaves stomata plays role in gaseous exchange and transpiration which is the evaporation of the aerial water of plants by opening and closing the stomata. Stomata are small pores mostly and normally present under the leaves and regulated by the guard cells, dum bell shaped cells to close or close it.

Other than closing and opening the stomata, stomata density also can affect the rate of gas exchange as well as transpiration. Stomata density is the presence of the numbers of the stomata per unit area. In heat or sunny area the stomata density is higher than the shady or dark area to increase the transpiration in order to cool down the leaves of the plant which prevent the chloroplast proteins to denature.

4 0
3 years ago
Other questions:
  • A suicidal client with a history of manic behavior is admitted to the emergency department. the client's diagnosis is documented
    8·1 answer
  • Your lab group is presented with an unknown mollusk. Your task is to assign it to one of the major taxonomic classes. Which char
    12·1 answer
  • URGENT!! WILL GIVE BRAINLIEST *IF IT IS CORRECT*
    8·2 answers
  • Please answer fast I,m in a hurry... In the skeletal system What parts of the system process the input?
    8·1 answer
  • If an atom of sodium has 11 protons, what is its approximate atomic mass?
    9·1 answer
  • . Complete the below sentences using: catalyst, intolerance, lactose, chemical reaction, reused, lactase
    6·1 answer
  • 5' ATGCCCGGGTGTCGTAGTTGA3' Complete the complementary sequence for the template strand
    5·1 answer
  • Which statements describe reverse faults? Check all that apply. The hanging wall moves up. The hanging wall moves down. The faul
    8·2 answers
  • Help me asap i’ll mark brainliest! pls and thanks
    10·1 answer
  • Which is not a reason the high specific heat of water is important on Earth?
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!