1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
ziro4ka [17]
3 years ago
9

As you can tell from their scientific names, they belong to different species. What taxonomic ranks do The medium ground finch (

Geospiza fortis) and the cactus finch (Geospiza scandens) share?
Biology
1 answer:
Alona [7]3 years ago
8 0

Geospiza is the study of bird species.

Medium ground finch (Geospiza fortis) and cactus finch (Geospzia scandens) they do share some taxonomic ranks

(i)                  They both have a genus of birds in the family of Thraupidaes.

(ii)                They are endemic to the Galapagos island.

(iii)               They are termed as Darwin’s finches.

(iv)              They belong to tanager family.

(v)                They contain hybrid species which nicknamed “BigBird” which is endemic to Daphne major.

(vi)              They both feed on primarily seeds. But can also feed on insects, buds, and young leaves.

(vii)             They are under parasitism of philornis downsi, as well as avian pox virus.

There are other taxonomic ranks which are not similar to each other for example:

(i)                  Geospiza fortis their natural habitat is subtropical or tropical dry shrubland and subtropical or tropical dry forest while Gespizia scadens their natural habitat is Arid lowland zones on each island.

(ii)                In Geospizia fortis their male plumage is solid black with white tips undertail and female plumage is brown and streaky.  Geospizia scaden which their male plumage is totally black while the female is brown and streaky.

You might be interested in
How does lead poisoning affect the nervous system?
Mandarinka [93]
When researchers examine these damaged nerves, they find that the myelin insulation is often gone and the axons are destroyed. These changes prevent nerves from transmitting messages properly.
A
4 0
3 years ago
Need help with dis !!
stealth61 [152]

Answer:garbage patches

Explanation:

4 0
3 years ago
Read 2 more answers
How are gymnosperm seeds and angiosperm seeds different?
Novay_Z [31]

Answer:

angiosperms have seeds that are closed within an ovary, gymnosperms have no flowers or fruits, and have unenclosed seeds on the surface of scales or leaves

4 0
2 years ago
Explain the precautions for immunizing children with Bruton's agammaglobulinemia.
topjm [15]

Answer:

Avoid using killed vaccine for administration.

Explanation:

Bruton's agammaglobulinemia may be defined as the X linked disorder that affects the immune system of an individual. This disease is mainly caused by the mutation in the gene responsible for coding the  Bruton tyrosine kinase.

The children suffering from this disease require special immunization and some precaution must be followed before immunizing them. These patients are not allowed to immunizes with the live vaccines as these vaccines can evoke the immune response strongly and child may get infected by the disease. The individual should not given immunosuppressive drugs or corticosteroids.

Thus, the answer is avoid using killed vaccine for administration.

8 0
3 years ago
Chaperone proteins or chaperones assist in the proper folding of proteins. Explain the process.
oksian1 [2.3K]

Proteostasis is mediated by chaperone proteins and protease systems, together with cellular clearance mechanisms such as autophagy and lysosomal degradation.

Chaperone proteins control assembly and inaccurate folding by binding to and stabilizing partly or completely unfolded protein polypeptides till the polypeptide chain is completely synthesized. Chaperone proteins also confirm the stability of unfolded polypeptide chains as they are being translocated into the subcellular organelles.

To learn more about Chaperone proteins here

brainly.com/question/28256423

#SPJ4

5 0
1 year ago
Other questions:
  • WHOS GOOD AT SCIENCE?! BRIANLIESTTT
    15·2 answers
  • A mono hybrid cross is made between plants that
    11·1 answer
  • All plantlike protists are always eutrophic.<br> True or False
    5·2 answers
  • Which process uses acetyl COA as a reactant?
    7·1 answer
  • Lisa wrote the following steps in the formation of metamorphic rocks.
    5·2 answers
  • A muscle contracts in response to an impulse carried by the type of neuron known as what
    13·1 answer
  • What are the characteristics of static electricity?<br><br><br><br><br> PLZZZZ HELPP!!
    10·1 answer
  • Which of the following animals has a solitary lifestyle ? A.sika deer B.elephant C. zebra D.rhino
    8·2 answers
  • The tRNA for GUCAUCGAUCGAUCGGAUGCC
    11·1 answer
  • We're do volcanoes usually form please help me A within 10 miles of the ocean B between earths mantle and core C at fault lines
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!