1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
notka56 [123]
3 years ago
8

Why does epithelial tissue require a connective tissue?

Biology
1 answer:
musickatia [10]3 years ago
7 0
Epithelial tissue lacks blood vessels, and forms surfaces, it is always found right next to connective tissue.

You might be interested in
Similarities and differences between fungi and plants?
gogolik [260]
Plants collect energy from photosynthesis, fungus feed off the dead.
7 0
3 years ago
The ______________ of the cerebral cortex are not involved in primary motor or sensory functions; rather, they are involved in l
Grace [21]

Answer;

-Association areas

The association areas of the cerebral cortex are not involved in primary motor or sensory functions; rather, they are involved in learning, remembering, thinking, and speaking.

Explanation;

-The cerebral cortex is divided into sensory, motor and association areas. Sensory areas receive and interpret impulses from sensory receptors , motor areas control movement of muscles (initiate impulses to skeletal muscles). Association areas are involved with more complex functions such as learning, decision making and complex movements such as writing.

-Association cortex is the cerebral cortex outside the primary areas, The majority of the cortex is composed of this area. It is essential for mental functions that are more complex than detecting basic dimensions of sensory stimulation.

3 0
3 years ago
1. What is the term for water entering the ground?
Luba_88 [7]
Absorbation is the term for when water enters the ground because it is the ground absorbing the water.
4 0
3 years ago
What is the mRNA in TACCGGATGCCAGATCAAATC?
Softa [21]

Answer:

AUGGCCUACGGUCUAGUUUAG

3 0
2 years ago
Which set of rational numbers is arranged from least to greatest? (4 points)
sveta [45]

Answer:

the answer for me is the third option (c)

8 0
3 years ago
Other questions:
  • Sunlight heats the ground, and the ground warms the nearby air. The warm air expands and rises, while cool air rushes in to take
    8·1 answer
  • What is the name for the compound with the formula Ba0
    15·1 answer
  • What does lipase digest?<br>A. Carbohydrates<br>B. Proteins<br>C. Fats
    14·1 answer
  • Explain why crossing-over is an important source of genetic variation. written response
    15·1 answer
  • What were Mendel's inheritance factors renamed?
    15·1 answer
  • Why do we need a universal name for an organism?
    8·1 answer
  • Write your question here (Keep it simple and clear to get the best answer) what name iz give to the female part of the flower?
    11·1 answer
  • CaF2 + H 2 SO4<br>CaSO 4 + 2HF que reacción química es<br>​
    10·1 answer
  • Giả sử trên phân tử ADN có số lượng của nu là A=450 g=900 Dựa vào nguyên tắc bổ sung tìm số lượng nu của các loại còn lại tổng s
    9·1 answer
  • 10. A Rock is a
    6·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!