How can high and low eq affect your ability to learn?

1 answer:

6 0

<span>Emotional quotient (EQ) , which is a measure of emotional intelligence (EI) , is the ability to to identify one's own emotions including the ability to differentiate and decipher emotions in people, pictures, voices, and cultural artifacts. The ability to process information of an emotional nature and relate those emotions to a wider cognition ability differ in humans. People with higher eq are more self-aware, this enables them to harness the mood (strength, lerthagy, weakness) during learning. They can tell based on the emotions of respondents whether the atmosphere is conducive for learning or not. A person with a high eq can capitalize fully upon his or her changing moods and others to best fit the task at hand. It enables them to harness emotions to facilitate various cognitive activities, such as thinking and problem solving. Unlike someone with low eq a person with high eq can harness emotions, even negative ones, and manage them to achieve intended goals.</span>

You might be interested in

An athlete who uses blood from another person for blood doping runs the risk of contracting a blood-borne disease because

Veronika [31]

Pathogens can exist in blood and then can be passed the transfusions

6 0

3 years ago

Read 2 more answers

Please help me with this

Rasek [7]

Answer:

GGCCATAGGTCCCTTTAGCG

Explanation:

I got a 100%

5 0

3 years ago

Please help!! Thanks

Anvisha [2.4K]

Answer:the big birds survived

Explanation:

8 0

3 years ago

Give two examples of how the endocrine system is important to the process of reproduction in humans?

Pepsi [2]

It wakes up the hormones in your body so you can reproduce in the first place, and it also helps to mature and prepare your body, and your cells, so it is able to reproduce. By waking up those hormones, your body is able to perform reproductive processes

7 0

3 years ago

Offspring grow up to exhibit many of the same characteristics as their parents because of the _______ they receive from their pa

faust18 [17]

Answer:

Genes

Explanation:

A gene is a hereditary unit that parents pass to their offspring, and they will determine the kind of characteristics the baby will have like will they be short or tall, have blue or brown eyes, will they have blond or black hair. The offspring will get different genes from its parents and it will therefore be genetically unique. Some traits or characteristics may be dominant over others. For example the mother has brown eyes and the father has blue eyes, so in this case eye color has two alleles (an allele is a specific version of a gene, in this case allele for blue eye color and an allele for brown eye color), and now the baby is born with brown eyes, so brown eye color was dominant over the blue eye color so that is the trait that we will see in the baby. The genetic is a lot more complex but this is a more simplified explanation of how offspring express certain traits from their parents.

8 0

3 years ago