1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Oksanka [162]
4 years ago
11

Earth's initial atmosphere probably contained higher levels of water vapor than today's atmosphere. Most of the water vapor left

the atmosphere due to the _____ of Earth.
A. cooling
B. rotation
C. warming
D. revolution
Biology
2 answers:
Elza [17]4 years ago
6 0

The best answer i see is A)- Cooling  

i hope this is right and it helps you

mezya [45]4 years ago
4 0

Answer:

Earth's initial atmosphere probably contained higher levels of water vapor than today's atmosphere. Most of the water vapor left the atmosphere due to the a) cooling of the earth.

Explanation:

To understand this answer we need to understand the characteristics of cold and hot air. First of all, hot air or in this case water vapor due to physics tends to go up, while cold air or vapor tends to go down. This can be observed in the process of raining. Vapor always goes up and comes down to earth in the form of water, mist or snow. However, in that time the vapor didn't come down and kept going up because the atmosphere was not developed and the earth's cooling was responsible for that. Because it didn't have the pressure and gravity it has today.

You might be interested in
Territorial behavior does not extend to organisms of different species. Please select the best answer from the choices provided
umka21 [38]

FALSE

All organisms use this "mechanism" to defend their food and shelter. Birds protect their nest just like all other animals and they fight for food.

I hope this answers your question.

Please remember to rate my answer and comment if you have any questions.

6 0
3 years ago
How can using a combination of policy tools be more efficient than using one exclusively?
8090 [49]
<h3>Answer:</h3>

c.   Using a combination of policy tools prevents the use of mandatory policies.

<h3>Explanation:</h3>

Regulating and controlling behavior is crucial for authorities. Authorities employ a number of tools such as enactment, penalties, laws, taxes, and support in order to change behavior in the concern of the people. The rising amount of policy difficulties has produced a difficulty for governments to control action. Moreover, conventional tools and methods in executing policy may be insufficient and ineffectual in circumstances of our current situation.

8 0
3 years ago
Read 2 more answers
2. Use the terms: technology and scientific theory in a<br> complete sentence.
mamaluj [8]

Answer: Andrew's scientific theory was that technology would someday be the world's main resource.

Hopefully this helped.

7 0
3 years ago
Read 2 more answers
The gustatory sense is dependent on _______ stimulation.
Novosadov [1.4K]
<span>The gustatory sense is dependent on B. chemical stimulation.
Gustatory sense is the taste sense - so different types of chemicals found in the food we eat or the liquids we drink make an impact on our taste sense, which is why we can feel different types of flavors. </span>
6 0
3 years ago
If a cell culture contains 400 cells/ml at time = 0 and it has a generation time of 30 minutes, how many cells (cells/ml) will b
Semmy [17]

Answer:

The answer to your question is: after two hours there will be 6400 cell/ ml

Explanation:

Data

Bacteria t = 0; 400 cells/ml

generation time = 30 minutes

# cells after two hours = ?

                                 # of bacteria               time

                                     400                            0

                                      800                         30 min

                                   1600                           60 min

                                   3200                           90 min

                                   6400                          120 min

7 0
4 years ago
Other questions:
  • Why can't HIV be transmitted through air?
    14·1 answer
  • A single strand of DNA is ATTCGGCTATTTACGATTGCCAT what is the other strand?
    8·1 answer
  • What happens when a cell is placed in a 0.3 solution<br> ...
    6·1 answer
  • At which point is crust neither created nor destroyed?
    6·2 answers
  • Analyze how different concentrations of solutes in a solution can affect organism's cells.
    11·2 answers
  • Is a rattle snake unicellular or multicellular
    10·2 answers
  • A child has brown hair and brown eyes. his father has brown hair and blue eyes. his mother has red hair and brown eyes. the best
    7·1 answer
  • 5. Which of the following explains a way in which metamorphic rocks are formed?
    14·1 answer
  • 15. A student is given the single strand DNA sequence below. Following the sequence from left
    13·2 answers
  • What are the best conditions for ginger root to grow?.
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!