Answer:
17. D) Hypothesis
18. Not accurate but it is precise
19. D) precision
20. A) quantitive observation
21. B) Control
22. Volume.
hope this helps!
Answer:
macronutrients
Explanation:
macronutrients are important for growing plants. the main macronutrients are nitrogen, Potassium, and phosphorus.
Based on the attached Image;
The two species that are likely to have the most similar DNA base sequences
are C and D. An evolutionary tree or a phylogenetic tree, like the one shown on the image is used to indicate which ancestors gave rise to which descendants. The tree represents the evolutionary relationships among a set of organisms or groups of organisms, called taxa. The tips of the tree represents groups of descendant taxa and the nodes represents the common ancestors of these descendants.
Answer:
This is a well conserved sequence.
Explanation: BLAST a way to match or align a string of DNA or protein sequence to those that are already in a database. The way that this is done is by using statistics carefully to calculate the significance of the match. The BLAST result will produce 4 categories Max Score, Total Score, Query cover, E-Value Percent Identity. The Accession will indicate database of the sequence. In this Sequence: AAGACCCGCCGGGAGGCAGAGGACCTGCAGGGTGAGCCAACCGCCCATTGCT covers over 98.08% identity to the coding sequence (cds) of insulin. This sequence appears to be in a conserved region for many of the listed organism. This suggest that this part of the coding sequence for this protein is highly conserved