1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Aleks04 [339]
3 years ago
14

How can a nutrient be a limiting factor in an ecosystem?

Biology
1 answer:
r-ruslan [8.4K]3 years ago
7 0
If a nutrient is short in supply, it will limit the organisms growth.
You might be interested in
Organisms that are similar in structure and form and successfully reproduce among
Goshia [24]
The answer is true.

8 0
2 years ago
Helpp aquatic questionnnnn will give brainliestt and most points i can​
olganol [36]

Answer:

17. D) Hypothesis

18. Not accurate but it is precise

19. D) precision

20. A) quantitive observation

21. B) Control

22. Volume.

hope this helps!

8 0
3 years ago
Which nutrients do plants need in larger quantities?<br> micronutrients<br> or<br> macronutrients
SCORPION-xisa [38]

Answer:

macronutrients

Explanation:

macronutrients are important for growing plants. the main macronutrients are nitrogen, Potassium, and phosphorus.

6 0
3 years ago
Which two species are likely to have the most similar dna base sequences?
saul85 [17]
Based on the attached Image;
The two species that are likely to have the most similar DNA base sequences are C and D. 
An evolutionary tree or a phylogenetic tree, like the one shown on the image is used to indicate which ancestors gave rise to which descendants. The tree represents the evolutionary relationships among a set of organisms or groups of organisms, called taxa. The tips of the tree represents groups of descendant taxa and the nodes represents the common ancestors of these descendants. 

5 0
3 years ago
BLAST (Basic Local Alignment Search Tool) is a powerful tool for comparing unknown sequences to sequences in online databases. I
storchak [24]

Answer:

This is a well conserved sequence.

Explanation: BLAST a way to match or align a string of DNA or protein sequence to those that are already in a database. The way that this is done is by using statistics carefully to calculate the significance of the match. The BLAST result will produce 4 categories Max Score, Total Score, Query cover, E-Value Percent Identity. The Accession will indicate database of the sequence. In this Sequence: AAGACCCGCCGGGAGGCAGAGGACCTGCAGGGTGAGCCAACCGCCCATTGCT covers over 98.08% identity to the coding sequence (cds) of insulin. This sequence appears to be in a conserved region for many of the listed organism. This suggest that this part of the coding sequence for this protein is highly conserved

3 0
3 years ago
Other questions:
  • Controlling blood glucose levels in the animation, you saw that both high blood glucose levels and low blood glucose levels are
    7·1 answer
  • What ( )is a component of soil made entirely of decomposed organic remains. This component increases soil fertility and what ( )
    11·1 answer
  • which of the following is a non point source of pollution A. a harbor. B. deepwater horizon oil spill. C. discharge from a facto
    13·1 answer
  • What is the difference between a stable and unstable element
    14·2 answers
  • Explain how traits that are not expressed in one generation can reappear in the next generation
    10·1 answer
  • A chloroplast has stopped producing atp and NADPH
    10·1 answer
  • Hi guys please tell me what r the methods to stop growth of population please answer it's urgent​
    6·2 answers
  • What techniques do you think Shubin and his fellow researchers used to determine how deep they should dig to look for Tiktaalik?
    9·1 answer
  • What causes the atrioventricular valves to close during a heartbeat? a Pressure in the atria is higher than in the ventricles. b
    7·1 answer
  • Mediante un grafico explicar breve y claramente como se realiza el proceso de la fotosintesis , cuales elementos intervienen y q
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!