1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
mariarad [96]
3 years ago
8

When you sit in front of a fire to warm your hands, it is an example of heat transfer by

Biology
2 answers:
igor_vitrenko [27]3 years ago
7 0
<span> its convection  hopes this helps </span>
VikaD [51]3 years ago
4 0
I believe its convection hope that helps
You might be interested in
Complete the following statement. Our solar system is part of the _________ galaxy.
zepelin [54]
The answer is C) milky way. Earth lives in the galaxy, which is apart of the milky way.
~Deceptiøn
6 0
3 years ago
Read 2 more answers
Name at least two of the microorganisms known to cause disease.
yarga [219]
Human Immunodeficiency Virus causes HIV
Varicella Zoster Virus causes chicken pox
3 0
3 years ago
Read 2 more answers
Which term refers to the study of how an organ functions?
vaieri [72.5K]

[ Answer ]


Physiology


[ Explanation ]


Physiology is the study of the functions and mechanisms in which your body works. It is how your body keeps you alive and how each part functions differently. It is how your organs, organ systems and cells keep you alive. They all perform different functions, but they all work together. It is almost like a car. Each part is different. The brakes stop the car, the gas makes the car go, this does this and that does that. However, even though they are all different, they all have one job; to make the car go from one location to the other. Physiology is the study of how each organ or cell does it's job. They explore deeper and reveal it's actual function.


<> Arsenal <>

4 0
4 years ago
TACAAACACTATACCGCGTAAATGATT Write the complement to the strand of DNA shown above, break it up into the proper triplets.
netineya [11]

Answer:

The complementary base pair is ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

Explanation:

As per the complementary base pairing rule of DNA

C pairs with G and vice versa

A pairs with T (in DNA) or U (in RNA)

Breaking the given strand into triplets, we get -

TAC  AAA  CAC  TAT  ACC  GCG  TAA  ATG  ATT

ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

5 0
3 years ago
Which increases the rate of speciation?
Blababa [14]

Answer:

Population bottleneck

Explanation:

Just took the test

4 0
3 years ago
Other questions:
  • Which of these is true about asexual reproduction? A) It leads to the birth of very few offspring at one time. B) Genetic inform
    9·1 answer
  • What are four properties that can be used to describe a mineral
    6·1 answer
  • In which body or cell area are most genes in humans located?
    15·1 answer
  • Hello how is everyone today?
    14·2 answers
  • Evidence for the theory of continental drift was first proposed in 1912 by what german scientist?
    11·1 answer
  • What must happen before a chemical reaction can begin? The activation energy must be exceeded. The activation energy must be rea
    16·2 answers
  • Since velocity describes both speed and direction, you can call it
    7·2 answers
  • Enzyme effectiveness in living cells is affected by
    11·1 answer
  • What is the main organic material found in the cell?<br><br>​
    7·1 answer
  • neuronal loss correlates with but exceeds neurofibrillary tangles in alzheimer’s disease. ann. neurol. 41, 17–24 (1997).
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!