1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Dimas [21]
3 years ago
14

How many atoms are in 1.75 mol CHCL3

Chemistry
2 answers:
vaieri [72.5K]3 years ago
6 0

1 mol = 6.022 x 10²³ atoms

In order to find how many atoms, dimly multiply the amount of moles you have by 6.022 x 10²³ or Avogadro's number.

So you have 1.75 mol CHC1₃ x (6.022x10²³) = 1.05385 x 10²⁴ atoms of CHCl₃

But now you have to round because of the rules of significant figures so you get 1.05 x 10²⁴ atoms of CHCl₃

Alex Ar [27]3 years ago
5 0
1 mol=6.022 * 10²³ (atoms or molecules)
1.75 moles of (CHCl3) we have: 1.75 moles*(6.022 10²³ molecules)=1.05385  10²⁴ molecules.

a molecule of CHCl₃ have, 1 atom of C, 1 atom of H, and 3 atoms of Cl, therefore a molecule of CHCl3 have 1atom+1 atom +3 atom=5 atoms.
Therefore:

1 molecule (CHCl₃)--------------------------------5 atoms
1.058385 10²⁴ molecules (CHCl₃)-------------    x
x=(1.058385  10²⁴ molecules* 5 atoms) / 1 molecule≈5.26925  *10²⁴ atoms.

solution: ≈5.269  10²⁴ atoms.

You might be interested in
The Sun heats land and water, how is this related to wind and ocean currents?
Yuki888 [10]

Answer:

"The sun warms up parts of the oceans. Warm waters rise just like warm air rises. So, as the warmer ocean waters begin to rise in a particular area, the cooler ocean waters from a different area will move in to replace the warmer ocean waters, and this creates our ocean currents."

Explanation:

Hope this is helpful :)

8 0
2 years ago
You have a mixture that contains 0.380 moles of Ne(g), 0.250 moles of He(g), and 0.500 moles CH4(g) at 400 K and 6.25 atm. What
Bas_tet [7]

Answer:

1.38 atm

Explanation:

Partial pressure of a gas = total pressure × mole fraction of that gas.

Mole fraction of a gas is moles of a gas ÷ total moles of all gases.

4 0
2 years ago
(NH4)2CO3à NH3 + CO2 + H2O For this unbalanced chemical equation, what is the coefficient for carbon dioxide when the equation i
nasty-shy [4]

Answer:

The answer to your question is the letter A. 1

Explanation:

Data

Chemical reaction

                   (NH₄)₂CO₃  ⇒   NH₃  +  CO₂  + H₂O

               Reactants    Elements     Products

                      2            Nitrogen             1

                       1            Carbon                1

                       8           Hydrogen            5

                       3           Oxygen                3

This reaction is unbalanced

                   (NH₄)₂CO₃  ⇒   2NH₃  +  CO₂  + H₂O

               Reactants    Elements     Products

                      2            Nitrogen             2

                       1            Carbon                1

                       8           Hydrogen            8

                       3           Oxygen                3

Now, the reaction is balanced,

The coefficient for Carbon dioxide is 1

6 0
3 years ago
Read 2 more answers
The density of iron is 7.8 g/cm3 and that of aluminum is 2.7 g/cm3. Using a balance, you find that a block of iron has the same
vazorg [7]

Answer:

1.The Aluminum block

2.its surroundings absorb energy from it.

Explanation:

In this question it is important to remember that density of an object is the mass of that object divided by its volume.

The expression applied here is density=mass/volume

Given that the mass is constant,lets say mass= m=1g

and density of aluminum=2.7g/cm³ and that of iron is 7.8 g/cm³ then volume=?

Volume=mass/density

Volume of aluminum= 1/2.7 =0.3704 cm³

Volume of iron = 1/7.8 =0.1282 cm³

Here we see volume of Aluminum block is the largest.

2.As water in an ice cube tray freezes, its surroundings absorb energy from it.When the water freezes, latent heat of freezing is given out to the surrounding.When water is freezing, it stays at a constant temperature of 0°C, the heat energy released ensures that there is no cooling past 0 °C.

8 0
3 years ago
From point A to point B, the car will . From point B to point C, the car will . Assuming the washer on the car is not blocked by
Natali5045456 [20]

Answer:

Accelerate, Have Constant velocity, Velocity, and First

Explanation:

Got it right on edge. have a wonderful day!!!

5 0
3 years ago
Read 2 more answers
Other questions:
  • Why can polar water molecules pass through a cell membrane?
    12·1 answer
  • What actions show conserving by reusing? Choose the two correct answers
    7·1 answer
  • How many equivalents are present in 10 g of Ca2+? <br> 1 <br> 0.5 <br> 1.5 <br> 2
    15·1 answer
  • Which is a chacteristic of a solution?
    7·1 answer
  • After the solution reaches equilibrium, what concentration of zn2 (aq remains?
    12·1 answer
  • What is the complementary DNA strand for the following sequence:<br> ATGGCTTGCCAAGGTCCGGAAACTTTG
    7·1 answer
  • A piece of metal that has a density of 5.2 g/cm3 and a mass of 100 g was placed in a full jar of water. How many mL of water was
    6·1 answer
  • a solid mass of 25 g is mixed with 60 g of a solution. a chemical reaction takes place and a gas is produced. the final mass of
    7·2 answers
  • Ricardo compra un gaseosa en el súper al destaparla la gaseosa comienza a salir espuma y vuelca la mitad al piso ¿Por qué puede
    11·1 answer
  • Which of the following best describes alternating current? ________
    5·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!