The excess moisture ( water) in the food items boils up immediately and busts both shortening and water around.
<h3>Reaction between hot shortening and water</h3>
Shortening are known to be fats at room temperature and are usually used in the baking of cakes and bread.
When placed in the temperature that is high, it melts to become liquid.
When you pour a food item that contains excess moisture on hot shortening, the water comes in contact with a higher temperature than the shortening's boiling temperature, so the water starts boiling immediately, and busts both shortening and water around.
Learn more about moisture here:
brainly.com/question/10398867
During transcription, a fragment of DNA is used as template to synthesize a complementary mRNA molecule. Subsequently, this mRNA is in turn used as a template to synthesize a protein by a process called translation.
In this case, the complementary mRNA sequence is:
- 3´GAGAGGGGGCGCCCCCGACAUGAUAGUACGCAGCAGAGCCAAUUAAA 5´
- Transcription is a molecular mechanism by which a fragment of DNA (e.g., a gene) is used as a template to synthesize a complementary RNA sequence, usually a messenger RNA (mRNA) sequence.
- Subsequently, this mRNA sequence is then used as a template to produce a polypeptide chain in the ribosomes by a process called translation.
- According to the base complementarity rules, Adenine always pairs with Thymine, whereas Guanine always pairs with Cytosine.
- In RNA, Thymine (T) bases are replaced by Uracil (U).
Learn more in:
brainly.com/question/837295?referrer=searchResults
1) symbiosis is a mutually beneficial relationship between two things.
2) the symbiosis in this example shows how the sea anemone provides the clown fish with protection and in return the clown fish helps the anemone by warding off any predators
Answer:
Hypotonic
Explanation:
Tap water contains a lot of solutes and ions that are absent in distilled water. The solution that has more solutes (more dissolved solids) will be the <em>hypertonic</em> solution.
Here, distilled water has no solutes, making it <em>hypotonic</em>.
