1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
V125BC [204]
3 years ago
5

What is the difference between active transport and passive transport

Biology
2 answers:
Irina18 [472]3 years ago
5 0
Active transport requires energy to transfer material in and out of the cell.

Passive transport is automatic and does not require energy. 


Examples of Active: Endocytosis and Exocytosis.

Examples of Passive: Facilitated Diffusion, Simple Diffusion, and Osmosis. 


Hope I helped! <u><em>HAPPY NEW YEAR!!!!!!!


</em></u>
<u><em /></u><em>can u mark me brainliest pls?</em><u><em>
</em></u>
Nezavi [6.7K]3 years ago
4 0
Active transport moves ions from low concentration to high, while passive transport moves ions from low concentration to high.

Woah that made me feel smart.....
Okay bye!
You might be interested in
What type of climate has no winters
tiny-mole [99]

Answer:

tryejjjjj

Explanation:

kkkkkk

6 0
3 years ago
Read 2 more answers
List and discribe five types of consumers
8090 [49]
The five types of consumers are, omnivore, herbivore, carnivore, scavenger, and detrivore/decomposer.
8 0
3 years ago
Read 2 more answers
Which pattern of evolution is seen in the relationship between algae and coral?
diamong [38]

Answer:

co-evolution  

Explanation:

8 0
3 years ago
Read 2 more answers
Why is adaption necessary for species survival ?
White raven [17]

All organisms need to adapt to their habitat to be able to survive. This means adapting to be able to survive the climatic conditions of the ecosystem, predators, and other species that compete for the same food and space

3 0
3 years ago
Read 2 more answers
The expected ratio of phenotypes among the progeny of a test cross is 1:1:1:1. Out of 200 total resulting progeny, 48 occur in o
Rzqust [24]

Answer: The progeny of this cross do not conform to a 1:1:1:1 ratio

Explanation: This is because out of the 200 total resulting progeny, we must have 50 in each phenotype class to conform with the 1:1:1:1 which is not so as we have 48 in one of the phenotypic class already. Therefore, it did not conform to the ratio.

3 0
3 years ago
Other questions:
  • The sequence of coding strand of a DNA molecule is given below. Assume that it is read from left to right. CCTACCTTATGCCAAGTTGGG
    15·1 answer
  • How do the human nervous system and endocrine system interact in
    9·1 answer
  • If the process of meiosis shown here proceeds normally, how many chromosomes will cells a, b, c, and d have? a 2 each b 6 each c
    13·1 answer
  • Match each biome with the correct description.
    8·2 answers
  • Ecologists believe that climate change is due partly to an increase in the concentration of
    12·1 answer
  • Let’s assume that dragons show incomplete dominance for fire breathing. The F allele provides lots of fire and the F’ allele giv
    9·1 answer
  • In fruit flies, the allele for red eyes, R, is dominant. Which genotype represents a white-eyed male fruit fly?
    7·2 answers
  • Which characteristics are common to most salamanders? Check all that apply.
    12·2 answers
  • Can the change in cyclin concentration during mitosis be explained by the fact that the cell divides in two and thus divides the
    13·1 answer
  • Which of the following does not act as a greenhouse gas and why? *
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!