1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
stiks02 [169]
3 years ago
5

The simplicity of prokaryotic cells prevents them from

Biology
1 answer:
iogann1982 [59]3 years ago
7 0
Forming specialized tissues & organs
You might be interested in
I NEED HELP PLEASE ASAP/Abigail's toaster produces 50 units of heat and 5 units of light for every 100 units of electricity it u
Svet_ta [14]
The answer would be 55 percent
8 0
3 years ago
The mineral magnetite is generally black or dark gray, with a metallic luster.
SSSSS [86.1K]

Answer:

Magnetite is black or brownish-black with a metallic luster, has a Mohs hardness of 5–6 and leaves a black streak.

5 0
3 years ago
What is the mRNA in TACCGGATGCCAGATCAAATC?
Softa [21]

Answer:

AUGGCCUACGGUCUAGUUUAG

3 0
3 years ago
The cell in this part of a plant transport water and nutrients throughout the plant. what is the most likely structure of specia
deff fn [24]

Answer:

I think the answer the will be option

a) the cells form long vertical tubes

Explanation:

This is because xylem transports water and minerals throughout the plant and they are long and vertical tubes

3 0
3 years ago
What would be the base sequence for the complementary DNA formed from the strand of DNA shown below? ATG CT
Bogdan [553]

The four nitrogenous bases in DNA are adenine, guanine, cytosine, and thymine. They pair A-T, G-C and when transfering with RNA, A-U, which is known as Uracil, so, the pairs would be...

ATGCT

↓↓↓↓↓

UACGA

I hope this helps!

5 0
4 years ago
Read 2 more answers
Other questions:
  • One area of land (region A) is made up of nothing but grasslands. Another area of land (region B) has grasslands, wetlands, and
    5·2 answers
  • How does asexual reproduction occur to budding
    12·1 answer
  • ________ is an inherited condition that affects the heme pathway; it leaves the skin scarred and gums degenerated, and may have
    9·1 answer
  • Can anyone help me with this?
    15·1 answer
  • Ecology review worksheet
    15·1 answer
  • A hormone that takes a while to produce an effect is most likely reacting in which manner?
    15·1 answer
  • how is mitosis different in plants and animals A. in plants, a new cell wall forms to split the cell B. in plants , the DNA is n
    14·2 answers
  • 5: Diagnosis of bacterial disease can be made by
    13·1 answer
  • Which type of precipitation forms when water droplets fall through a cold layer of air and freeze on their way to the ground?
    9·2 answers
  • Which is NOT a similar function of all cells?
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!