Transcription factors are necessary for an initiation of transcription at a regulated gene but not sufficient.
Transcription is the first step of gene expression in which DNA molecule is copied (transcribed) into RNA (mRNA) by RNA polymerase. The process of transcription is divided into three phases:
1. Initiation
• RNA polymerase with transcriptional factors bind to gene promoter Transcription factors can enhance the interaction between RNA polymerase and a DNA sequence- promoter, encouraging the expression of the gene. Such transcription factors are called activators. Otherwise, when the gene expression is inhibited, factors are called repressors and they bind to sequence –operator.
• RNA polymerase unwinds DNA double helix (transcription bubble is formed)
2. Elongation
• RNA polymerases adds nucleotides complementary to DNA
3. Termination
• RNA polymerase gets to stop codon (transcribes a sequence of DNA known as a terminator)
• Formed complementary RNA strand is released from DNA-RNA complex
Answer:
Apparently 0 is the answer which makes sense
Explanation:
https://www.tiger-algebra.com/drill/(x-5)(x_1)/3(x_1)=x-5/3/
AUGCGAGGUAUAGCGAUUAGCGGCCUAGUCUAA because A goes to U; T goes to A; G goes to C; C goes to G.
The United Nations Conventions on the Law of the Sea (UNCLOS) stipulates that seabed area, which is not within the landmark of any particular country should be regarded as a common natural heritage. Consequently, any mineral found in such an area can be used by anyone.
However, because of the abundant presence of sea area, and the way national boundaries often conflict, coupled with the problem of illegal mining practices, such laws are difficult to enforce, and so these regulations are not standardized yet.
Some possible impacts of ilegal seabed mining are:
1. Destabilisation of oceanic systems.
2. It constitutes danger to the organisms living in the hydrothermal vents.
Answer:
Both extract from the soil while difference in their extraction method.
Explanation:
Harvesting food crops similar to mining because both are gained from the soil whereas it is also different from mining due to their method of extraction. Seeds are grown again and again in the soil and other agronomic activities has to be done to gain good yield of the crops while on the other hand, in mining precious metals is to be extracted that is already present in the soil.
