1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Alla [95]
3 years ago
12

1) How is DNA condensed to form a chromosome?

Biology
1 answer:
frosja888 [35]3 years ago
7 0

Answer:

Hello! Here are the answers:

  1. Chromosomes are a highly condensed form of a combination of DNA and protein called chromatin. DNA strands (negatively charged) are tightly wound around these proteins called histones (positively charged) to form chromosomes.
  2. Mechanism genes code for for proteins that govern life processes. These genes or portions of DNA  are called exons. DNA segments between these exons are called introns that strictly code for regulatory proteins and also contain genetic regulatory elements (DNA sequences that control gene expression).
  3. Gene expression is the process of translation of DNA sequences into proteins. The genetic code is the nucleotide sequence in the DNA itself that codes for different amino acids that combine together to form a functional protein.

Explanation:

* 2. The intronic regions are misleadingly referred to as "junk DNA" but introns code for crucial regulatory elements that control gene expression.

* 3. The genetic code determines the sequence of amino acids in various proteins.

You might be interested in
WILL GIVE A BRANILEST AND 20PTS
Ymorist [56]
Hello Ziplovin31, widespread hunting of predators may result in <span>overpopulation of prey.</span>
7 0
3 years ago
Read 2 more answers
Select all the advantages of a multienzyme complex over a metabolic pathway
Kazeer [188]

Answer:

Option A, B, C

Explanation:

The major advantages of multienzyme complex over a metabolic pathway is that it do not require individual pathway for each enzyme activation or inhibition. Instead it responds efficiently to the equilibrium changes of substrate supply and demand as compared to that of enzymes.

It tightly regulates the processes and is also faster than that of the metabolic pathway.

Hence, option A, B and C are correct

8 0
3 years ago
Los autosomas son aquellos cromosomas que se caracterizan por
bearhunter [10]

Answer:

Los autosomas o cromosomas autosómicos han sido ordenados de acuerdo a la morfología que poseen. ... Cada par de cromosomas son homólogos, es decir, contienen genes idénticos, con la misma ubicación a lo largo de cada cromosoma (locus). Ambos codifican para las mismas características genéticas.

Un autosoma es cualquier de los cromosomas, excepto los cromosomas sexuales. Los humanos tienen 22 pares de autosomas y un par de cromosomas sexuales (el par número 23, formado en las mujeres por dos cromosomas X y, en los hombres, un cromosoma X y un cromosoma Y).

3 0
3 years ago
5’AUGAGGGCGAGCGGCGCCCACGUUUUAGGGUGA3’
stepladder [879]

I believe this is translation and it occurs in the mRNA strand due to proteins call the initiation, elongation and release factors.

7 0
3 years ago
Which organic compound is NOT correctly paired with its monomer?
Aloiza [94]
Call you later today I have a lot to talk about it
3 0
2 years ago
Other questions:
  • Tetanic muscle contractions don't occur in a normal cardiac muscle because
    7·1 answer
  • Changes in blood osmotic pressure would most affect the secretion of
    10·1 answer
  • Description of change 2011 japan tsunami
    10·2 answers
  • mitochondria are important organelles within a cell. what would most likely happen if a cells mitochondria were not functioning
    13·2 answers
  • A child who is being abused and/or neglected is dealing with?
    9·2 answers
  • What are the main idea of the cell theory?
    10·2 answers
  • 22 points!
    7·1 answer
  • How are the length,density, and the shape of an object related to the crater is formed?
    6·1 answer
  • What is the role of plastic in your life?
    15·1 answer
  • What is pisciculture?​
    9·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!