1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
soldier1979 [14.2K]
4 years ago
12

What process involves the turning off or on the genetic information of a cell?

Biology
2 answers:
icang [17]4 years ago
8 0

Answer: the CORRECT answer is differentiation

Explanation:

FromTheMoon [43]4 years ago
3 0
Gene regulation is the answer
You might be interested in
Khorana used synthetic mrnas to determine genetic code possibilities. to do so, he translated synthetic mrna in vitro in the pre
meriva
For the answer to the question above, I think this is <span>False and the answer is based on the book, Nirenberg, and Matthaei. 19- unlabeled amino acids. Cys-Val-Cys-Val. (pg. 318 & 319)</span>. I hope I helped you somehow. Have a nice day!
7 0
3 years ago
3 ways humans have cut and frayed the woven tapestry of earths biodiversity
WITCHER [35]

Three ways that humans have cut and frayed the woven tapestry of earths biodiversity:

1.       Landscaping. By landscaping, living things such as trees are eliminated to make way for the construction of buildings. And thus, disrupting the ecosystem.

2.       Adding cement to the ocean to increase the land surface area by excavating soil from the maintains.

3.       Cutting of trees.

8 0
3 years ago
Why are elephants' traits are changing over time.
Ksju [112]

Answer:

because they adapt and change by learning new behavioral traits and develop new physical traits

Explanation:

6 0
3 years ago
TACAAACACTATACCGCGTAAATGATT Write the complement to the strand of DNA shown above, break it up into the proper triplets.
netineya [11]

Answer:

The complementary base pair is ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

Explanation:

As per the complementary base pairing rule of DNA

C pairs with G and vice versa

A pairs with T (in DNA) or U (in RNA)

Breaking the given strand into triplets, we get -

TAC  AAA  CAC  TAT  ACC  GCG  TAA  ATG  ATT

ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

5 0
3 years ago
Which of the following pairings of phylum and description is incorrect? A Echinodermata—bilateral symmetry as a larva, coelomate
Flura [38]

Answer:

Porifera—gastrovascular cavity, coelomate.

Explanation:

Sponges do not contain digestive system but obtain nutrients through the diffusion process. Porifera is the most commonly asymmetrical in nature but can also have radial symmetry. Porifera has no coelom.

Lacking a true digestive system, they depend on the intracellular digestive processes of their choanocytes for their energy intake. Gas exchange, circulation, and excretion occur by diffusion between the water and the cells.

6 0
3 years ago
Other questions:
  • How are chromosomes related to cancer
    5·1 answer
  • What is one major effect of scientific research in biology?
    10·2 answers
  • 19. Which structure is the boundary between a living cell and its environment?
    13·2 answers
  • The active site of an enzyme is the region that The active site of an enzyme is the region that binds allosteric regulators of t
    14·1 answer
  • HELP - State a role of decomposers in this food web. PLEASEE
    8·1 answer
  • Which type of strength training uses machine-generated forces to increase muscle strength and endurance? A. bench pressing B. po
    9·2 answers
  • This structure serves as the garbage collector / waste disposer for the cells: _____________________________
    12·1 answer
  • A vector on an x/y graph runs from the origin (0,0) to the point (-6,-3). Which of the following could be a horizontal component
    5·1 answer
  • Explain the importance of fossils and how they provide evidence for evolution.
    5·1 answer
  • Analyze the table illustrating the events of mitosis and cytokinesis. The table outlines the potential activity of the chromosom
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!