1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
oksano4ka [1.4K]
3 years ago
9

If light strikes one receptor, the net effect is to ________ the nearest bipolar cell and ________ other bipolar cells to the si

de because of the contributions from ________ cells.
Biology
1 answer:
mrs_skeptik [129]3 years ago
4 0

If light strikes one receptor, the net effect is to excite the nearest bipolar cell and inhibit other bipolar cells to the side because of the contributions from horizontal cells.

<u>Explanation:</u>

On striking the receptor with light, the nearest bipolar cells respond to the light at the most inside the circumference. The bipolar cells which are outside the circumference responds least to the phenomena. Overall, the net effect thereby when seen, is to excite the nearest bipolar cells.

By the excitement of nearest bipolar cells, other farther cells are inhibited as a result as the horizontal cells are also excited and they contribute to inhibit the bipolar cells which are not near to the receptor cells in the eyes.

You might be interested in
The Calvin cycle is another name for the
dem82 [27]
The answer is C. Photosynthesis Reaction. Hopes this helps :D

3 0
3 years ago
How can recycling impact the environment? A) It uses less energy to make something from recycled materials than from new materia
o-na [289]

Answer:

A) It uses less energy to make something from recycled materials than from new materials.

Explanation:

When a recycled material is used to make a new product, it conserves energy because the recycled materials have already been processed once; so making something from it for the second time uses less energy-intensive than the first. For example: Making new aluminium from old products uses 95% less energy than making it from scratch.

Hence, the correct answer is "A)"

8 0
3 years ago
This biome is warm and wet, with little seasonal variation in temperature and frequent precipitation.
Ainat [17]

Tropical rainforest is a biome which  is warm and wet, with little seasonal variation in temperature and frequent precipitation.

<h3>What is a Biome?</h3>

This is referred to an environment which has features such as being greatly influenced by abiotic factors such as sunlight, water etc.

Tropical rainforest as the name implies has a large and frequent amount of precipitation thereby making it wet with little seasonal variation in temperature. It is also characterized by large trees which form canopies in the region.

Read more about Tropical rainforest here brainly.com/question/1146251

#SPJ1

6 0
1 year ago
Gregor mendel crossbred pea plants for a variety of traits. What did he learn about dominant and recessive traits?
vladimir1956 [14]
Gregor Mendel crossbred two different pea plants. One of the plants had yellow peas (a dominant trait) and one of the plants had green peas (a recessive trait). The yellow pea plant was heterozygous for its trait meaning its alleles will be Yy. The green plant, because it is recessive, was homozygous for its trait, yy. When these plants were crossbred, two of the offspring resulted in heterozygous for the yellow trait and the other two offspring were homozygous for the green trait.
4 0
3 years ago
Which process is responsible for producing eggs and sperm?
Kobotan [32]

Answer:

Sexual Reproduction

Explanation:

Hope this helped!

6 0
3 years ago
Read 2 more answers
Other questions:
  • Which of the following pulmonary term correlates with the definition: bronchospasm of the bronchial walls?
    8·1 answer
  • The famous scientist Galileo Galilei did several experiments with sloping
    5·2 answers
  • I need to put these in order
    13·1 answer
  • ......................
    6·2 answers
  • How do I use a codon wheel to solve this sequence of DNA?<br><br> AGTACCCGTTAATTAGTTGCCG
    5·1 answer
  • Scientists are using genetic engineering to develop a wheat crop that is resistant to a particular kind of moth. How would they
    11·1 answer
  • Dr. Smith's parents have normal hearing. However, Dr. Smith has an inherited form of deafness. Deafness is a recessive trait tha
    13·1 answer
  • The period of development is the time from conception to birth. (Watch your spelling!)
    14·2 answers
  • Allopatric speciation is another name for
    7·2 answers
  • PLEASE HELP!!!
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!