1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Viefleur [7K]
3 years ago
15

Circle the letter of each example of mechanical weathering.

Biology
1 answer:
Elan Coil [88]3 years ago
5 0

\huge{Heya!}

<h3>The answer to this will be is : </h3><h2 /><h2>C. Plant roots grow into a crack in a rock.</h2><h2 /><h2>\textbf{EXPLANATION :}</h2><h2 />

▁▁▁▁▁▁▁▁▁▁▁▁▁▁▁▁▁▁▁▁

Because "mechanical weathering" It's a example of the Plants roots that grow on into a crack in the rock.

Hope It Helped!

<u>And Tell me if The answer is wrong. . .</u>

<h2><u>Good Luck With Your Assignment!</u></h2><h2 />

#LearnWithBrainly

\text{\underline{ANSWER :}}

\textbf{Jace} ノシ

You might be interested in
What conclusions can we draw from the lab about photosynthesis and cellular
GuDViN [60]

Answer:

Carbon dioxide and oxygen are recycled through photosynthesis and cellular

respiration forever unless something interrupts.

Explanation:

Photosynthesis and cellular respiration are two distinct and opposite metabolical processes undergone by living cells. They are opposite processes because one utilizes the products of the other as reactants.

Photosynthesis is a unique process to autotrophic organisms like plants. It is the process whereby plants synthesize their food in form of organic molecules (glucose) by combining Carbondioxide (CO2) and water (H2O) in the presence of sunlight.

The overall equation of photosynthesis is as follows:

6CO2 + 6H2O ------> C6H12O6+ 6O2

On the other hand, cellular respiration is the process whereby living cells obtain energy (ATP) by breaking down food molecules (glucose) using oxygen to produce carbondioxide (CO2) and water as products. The overall equation is:

C6H12O6 + 602 -----> 6CO2 + 6H2O

Based on the lab experiments, it can be concluded that Carbon dioxide and oxygen are recycled through photosynthesis and cellular

respiration because photosynthesis recycles/reuses the products of cellular respiration, which are C02 and H2O while cellular respiration recycles/reuses the products of photosynthesis, which are C6H12O6 and O2. This process occurs naturally in the environment and will continue to do so unless something interupts.

Option B is incorrect because light energy from the sun powers photosynthesis while option C is incorrect because photosynthesis transforms light energy to chemical energy while cellular respiration transforms chemical energy to thermal energy.

7 0
3 years ago
Lymphatic collecting vessels are most closely associated with __________.
IgorLugansk [536]
The answer you are looking for is:<span>capillary beds</span>
3 0
3 years ago
How are fruits and vegetables made available in the off season
Aneli [31]

Answer:

They can preserve food in the cans, in the refrigerator and make them frozen, in the green houses to preserve them in the off season.

This is all how you can preserve food in the off season.

<h3>Hope this helps.</h3><h3>Good luck ✅.</h3>
6 0
1 year ago
What would indicate that a bacteria species that is successfully stained purple by a gram stain?
goldfiish [28.3K]

Answer:

Gram positive; Contain thick mesh wall of peptidoglycan in cell wall.

Explanation:

  • Gram staining technique is used to separate the gram positive and gram negative bacteria on the presence or absence of thick layer of peptidoglycan in cell wall.
  • If a bacteria contain thick layer of peptidoglycan in cell wall it will retain the primary stain crystal violet (purple) and known as gram positive bacteria.
  • If bacteria don't have thick layer of peptidoglycan in cell wall the stain will wash out and it will give the pink color known as gram negative bacteria.
  • Peptidoglycan is glycoprotein or Glucose+Protein.

5 0
3 years ago
CCGCTTTCGCTATTATAAAAAGGGCTATAACTA
miss Akunina [59]
A because like what even is this??
4 0
3 years ago
Other questions:
  • This morning in class, oya learned about the way neighboring neurons are involved in the firing of an individual neuron. If enou
    15·1 answer
  • Which type of reproduction, sexual or asexual, is best suited for organisms that live in a place where environmental conditions
    8·1 answer
  • How would you buffer a solution that has a pH of 12
    11·1 answer
  • A molecule that can be used as a molecular clock has a neutral mutation rate of one mutation per 5 million years. How many years
    6·2 answers
  • Plz help I will mark you brainlist plz help​
    13·1 answer
  • Damaged tissue releases chemicals that activate platelets and stimulate the formation of blood clots. Which of the following pre
    14·1 answer
  • A gain or loss of a proton creates an isotope.<br> True or false
    13·2 answers
  • In fruit flies the allele for long wings (L) is dominant and the allele for short wings (l) is recessive. What is the likely gen
    7·1 answer
  • Explain they transitional fossils provide powerful evidence for common descent
    12·1 answer
  • Match the following characteristics to the appropriate ecosystems.
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!