All categories

2 years ago

PLZ HELP 80PTS!!! What sex is the person who has the karyotype described in Steps 3-4? How do you know?

1 answer:

5 0

I can’t help you with the first two questions, as I do not have a reference, but I can help you with the last two. Cystic fibrosis is a recessive trait. It is caused when specific sections of both copies of chromosome 8 are deleted, which in other words mean that it is not a sex-linked disorder because it isn’t inherited from the mother and father of the offspring.

No, all mutations are not bad. Only a small amount of mutations cause genetic disorder. Some in fact are good mutations. There is actually one mutation that is found roughly in 10% of Europeans which affects the CCR5 protein and it prevents HIV from entering the cell!

You might be interested in

The concentration of calcium inside a cell is 0.3%. the concentration of calcium outside the cell is 0.1%. how could the cell tr

Snezhnost [94]

Bone density less calcium

8 0

3 years ago

The adaptation that allows some of these animals to run fast would be an example of natural selection if it helps them

ad-work [718]

Answer:

a chaeta runs fast to catch its pray Please Mark Me Brainliest

Explanation:

8 0

2 years ago

You are examining the phylogenic relationship of a newly discovered plant species (Species 2). You amplify the RUBISCO barcode a

frozen [14]

Answer:

a. Inversion

b. Duplication

Explanation:

Inversion has the name suggest, has to do with a segment of DNA being reversed from end to end.

In this case here,

Inversion is taking place here.

species 1 ATGCAAATTTGGGCCCATGAATGGTTGCAA

species 2 ATGCAAAAATTTTGGTACGCCGAATGGTTGCAA

Therefore, the sequences in bold in species 1 are observed to be reversed end to end in species 2.

Deletion ❌❌

I am sure it's not feasible because deletion entails removal of a few sequences.

It can be seen that species 2 is longer than species 1, which gives another reason why deletion is not feasible too, as no sequences are seen to be deleted.

I believe duplication is feasible since AATT sequences are repeated once.

Our final answer,

inversion and duplication occur here.

4 0

3 years ago

How does the structure of water contribute to its unique properties

frutty [35]

So basically water is a polar molicule. So when it comes to the structure, water is able to form many hydrogen bonds and the way the atoms are able to bond together adds to the water's special properties.

8 0

3 years ago

The diagram below shows the stump of a tree whose root grew into a small crack in bedrock and split the rock apart.

Drupady [299]

Answer:

Physical Weathering

Explanation:

As per the given conditions in the question, the primary effect is mechanical action which is also known as a physical weathering. During mechanical action, a rock is disintegrated into the smaller pieces. In the given statement, the root of tree would grow in the crack and try to develop a strong network to get nutrients necessary for tha tree growth. Thus, the root would exert a pressure in the crack to make more space for its growth and development (root network). This is primarily a mechanical action and an example of physical weathering.

5 0

3 years ago