1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
True [87]
3 years ago
9

Nitrogen is necessary for building these two organic molecules:

Biology
1 answer:
Lemur [1.5K]3 years ago
6 0

Answer:

D

Explanation:

the major constituents of carbohydrates are carbon, oxygen, and hydrogen while protein contains nitrogen,carbon, hydrogen,and some mineral elements, and lipids major constituents are carbon, hydrogen and little oxygen.

the nucleic acids are packed with histones, which is proteinous, and contain nitrogen too

You might be interested in
What is the complementary strand for the following DNA segment? C A A G T T C G A T G A
Kazeer [188]

GTTCAAGCTACTGTTCAAGCTACT

6 0
3 years ago
When a cold can of soda is insulated, the heat flow into the can on a hot day ____.
maksim [4K]
The word insulate means to protect from heat, cold,...
So when a can is insulated, means that is protected from heat.
So the answer is:
C. stays the same :)))
I hope this is helpful
have a nice day
4 0
3 years ago
Read 2 more answers
List three ways that reproductive isolation occurs
____ [38]
Hello

When populations have differences in rituals or behaviors. When populations are separated by rivers, mountains, r bodies of water.

Hope this helps
Plz mark me as brainliest
6 0
3 years ago
The diagram shows the process of transcription, which takes place in the nucleus of a cell. What is occurring?
chubhunter [2.5K]
<span>Transcription is the process by which the information in a strand of DNA is copied into a new molecule of messenger RNA (mRNA). DNA safely and stably stores genetic material in the nuclei of cells as a reference, or template. Meanwhile, mRNA is comparable to a copy from a reference book because it carries the same information as DNA but is not used for long-term storage and can freely exit the nucleus. Although the mRNA contains the same information, it is not an identical copy of the DNA segment, because its sequence is complementary to the DNA template.</span>
8 0
3 years ago
Read 2 more answers
High heat or vaporization
zepelin [54]
Vaporization.........
4 0
3 years ago
Other questions:
  • Through which of the following materials do sound waves travel the fastest?
    10·2 answers
  • What would happen if (G) guanine lined up with (T) thymine during meiosis. Please help me with this.
    13·1 answer
  • to study cells with a light microscope different types of stains are usually avaible why is it generally more useful to stain eu
    11·1 answer
  • What is the relationship between blood and urine ?
    15·1 answer
  • During which phase of meiosis does crossing over occur?
    5·2 answers
  • An organ which regulates buoyancy
    7·1 answer
  • *urgent* What is the genetic information called in Anaphase II? What is another source of genetic variation during metaphase I?
    12·1 answer
  • Think of an object, person place at home that functions similar to the vacuole.
    9·1 answer
  • 6. Can I sell my organs? Why or why not?
    13·1 answer
  • She always prepared food.(Yes/No question)​
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!