1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
ruslelena [56]
3 years ago
9

Select all that apply. What characteristics do mutations have? 1. always harmful 2. occasionally beneficial 3. omission of infor

mation 4. addition of information 5. mistakes in copying
Biology
2 answers:
krok68 [10]3 years ago
7 0

Answer:

2.) occasionally beneficial

3.) omission of information

4.) addition of information

5.) mistakes in copying

Explanation:

     Mutation can be defined as any change in the genetic material of an organism.

     This change may cause a corresponding change in the phenotype of the individual.

     Mutations can occur spontaneously or induced.

     Spontaneously, it occurs due to errors in DNA replication. And induced, when the organism is exposed to a mutagen, such as radiation.

     Mutations can occur in somatic or germ cells.

     In gene mutation there may be substitution, deletion or insertion of one or more bases in the DNA strand.

     Chromosomal mutation refers to any change in the number or structure of chromosomes.

Drupady [299]3 years ago
4 0
2.) occasionally beneficial

3.) omission of information

4.) addition of information

5.) mistakes in copying
You might be interested in
The longmenshan fault is in china. this fault was created when two tectonic plates collided with each other, resulting in the ri
victus00 [196]

The longmenshan fault is in china. This fault was created when two tectonic plates collided with each other, resulting in the rise of mountains next to the sichuan basin. This fault is most likely a reverse fault.

A reverse fault is a fault that exists in areas that are undergoing compression in which the rock on top of the fault plane is moved upward relative to the rock under the fault plane. A reverse fault is completely different from normal faults and it reduces the faulted section of rock.

3 0
3 years ago
Read 2 more answers
Which of the following best describes the effect the moon has on the tides?
Anit [1.1K]

Answer:

A The gravity of the moon pulls the ocean, which causes the tides.

Explanation:

Well all of the other answers are just completely different.

if the moon is invisible tides cannot be seen, but why is it at night it is called high tide. B is very odd because many surfing events happen during the day.

It is A because it contains the most context, because it is the only reliable and realistic option, because when the moon is up, and the sun is down, it causes stronger waves

5 0
3 years ago
Periods of growth for the economy followed by downturns describes _____. real GDP final goods and services economic cycle
Fittoniya [83]

The correct answer is Economic cycle.

The natural fluctuation in economy between the period expansion (economy growth) and contraction (recession) is known as the economic cycle.  

The normal growth and downturn in the economy is the basic definition of Economic cycle.

During the time of expansion the investors seek to purchase companies and shares and during the time of contraction the investors look to invest and purchase the companies such as utilities and healthcare.

7 0
3 years ago
Read 2 more answers
True or False. In pernicious anemia, oxygen depletion in the body becomes apparent withing the first 6 months of life.
mylen [45]

False, pernicious anemia may take up to 5 years to show symptoms. However, the oxygen starts to get depleted within the first 6 months in thalassemia major.

Pernicious anemia:

In this condition, the body is unable to absorb vitamin B12 which leads to lowered amount of red blood cells which are responsible for carrying oxygen throughout the body. It is an autoimmune disease in which antibodies attack their own cells in the lining of the stomach which affects the absorption of vitamin B12. The symptoms of pernicious anemia are dizziness, fatigue, diarrhea, constipation, breathlessness, and loss of appetite. The depletion of oxygen is seen in thalassemia major within 6 months.

Learn more about pernicious anemia here,

brainly.com/question/14659619

#SPJ4

3 0
2 years ago
What organisms are responsible for decomposing organic matter? Why are they essential? A. heterotrophs; they return biotic mater
UNO [17]

Answer: Option C - decomposers; they return biotic material to the abiotic component of the Earth

Explanation:

Decomposers are also known as SAPROPHYTES. They feed on and break down dead and decaying remains of plants and animals, thus enabling the release of certain compounds like ammonia, methane gas etc into the environment that then enrich/improve the soil fertility.

7 0
3 years ago
Other questions:
  • 01.03]Which of the following statements about science is true? Science is built on opinions and assumptions. Science is tested b
    12·2 answers
  • The sequence of coding strand of a DNA molecule is given below. Assume that it is read from left to right. CCTACCTTATGCCAAGTTGGG
    15·1 answer
  • What is a monomer of a protein?
    10·1 answer
  • Which of the following adaptations enables deciduous trees to produce more food?
    14·2 answers
  • (I NEED MAJOR HELP IN SCIENCE)(OFFERING 1000 POINTS)
    8·2 answers
  • A farmer has a breed of yellow tomatoes. However, the farmer thinks that they would sell better if they were bright red. 1. Expl
    5·1 answer
  • The evidence of Evolution are....
    13·2 answers
  • I need an answer for this ASAP!!
    8·1 answer
  • Skin is an important part of the immune system. It acts as a ____________ boundary between germs and your body.
    10·1 answer
  • Explain the terms of obligate categories discuss the various intermediate categories.​
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!