1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Ad libitum [116K]
3 years ago
11

Explain the relationship between the sarcoplasmic reticulum and the transverse tubules

Biology
1 answer:
strojnjashka [21]3 years ago
6 0
Sarcoplasmic reticulum resembles endoplasmic reticulum found in other cells; they are structures that surround the myofibrils of skeletal muscle fibers. T tubules or transverse tubules run perpendicular to the axis of the fiber and extend across the surface of sarcoplasmic reticulum. It's role is to conduct impulses from sarcolemma to cell and to sarcoplasmic reticulum.
You might be interested in
5’AUGAGGGCGAGCGGCGCCCACGUUUUAGGGUGA3’
stepladder [879]

I believe this is translation and it occurs in the mRNA strand due to proteins call the initiation, elongation and release factors.

7 0
3 years ago
Why did Mendel study one trait at a time?
dexar [7]

Gregor Mendel conducted hybridization experiments on around 29,000 pea plants. Peas were an ideal choice for Mendel to use because they had easily observable traits there were 7 of which he could manipulate.

7 0
3 years ago
PLZ HELP BRAINLEST!
son4ous [18]
1) This includes two leaf-feeding beetles, one root-boring weevil and one flower-feeding weevil. ... calmariensis are leaf-eating beetles which seriously affect growth and seed production by feeding on the leaves and new shoot growth of purple loosestrife plants.
7 0
2 years ago
What is the study of the distribution of living organisms and fossils around the world
Novay_Z [31]
The study of distribution of living organism is kow as demography, while studying their fosils is known as paleantology.
7 0
2 years ago
Read 2 more answers
carbon dioxide can be produced by what type of power generation A. coal B. solar C. hydroelectric D. winde
mart [117]
A. Coal 

hope it helps you!
5 0
3 years ago
Read 2 more answers
Other questions:
  • The events taking place in two different locations are described below: Location A: Movement of plates causes hot spots to move
    5·1 answer
  • What are the functions of carbohydrates, lipids, protein, and Nucleic Acids?
    11·1 answer
  • The class of disorders marked by extreme and inflexible characteristics that often cause impaired social and occupational functi
    11·1 answer
  • This genetic map is for chromosome 2 of the Drosophila genome. The map shows the location of genes responsible for different rec
    11·1 answer
  • Taking big particles inside the cell by using energy is called _______
    13·2 answers
  • Scientist Year
    6·2 answers
  • What is mutation, effects and patterns of inheritance and data analysis?
    8·1 answer
  • Which stage is the dominant stage in mosses?
    5·1 answer
  • Free 19 points -w- hurry and claim em before their gone
    8·2 answers
  • Which of these is an example of weather?
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!