1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
seropon [69]
3 years ago
15

What is the largest type of plant in the world that does not have a wooden stem?

Biology
1 answer:
goldenfox [79]3 years ago
6 0
The  <span>sunflower is considered to be the largest plant without a wooden stem. The sunflower will usually grow more than 120 inches. </span>. It have a hairy stem but it is not wooden, is soft line the plant vines. It tilt during daytime because it usually face the sun. 
You might be interested in
Describe 3 ways a mutation can occur?
Blababa [14]

These changes can be caused by environmental factors such as ultraviolet radiation from the sun, or can occur if an error is made as DNA copies itself during cell division. Acquired mutations in somatic cells (cells other than sperm and egg cells) cannot be passed to the next generation.

:333


3 0
3 years ago
A disaccharide is formed when two monosaccharides join. Which of the following is a disaccharide?
kaheart [24]

The correct answer is: Glucose and fructose

Glucose and fructose are monosaccharaides that are joined by glycosidic linkage to form sucrose. This disaccharaides are produced naturally in plants but for human production it is is extracted, and refined, from sugar cane.

Lactose and maltose are also disaccharides. Lactose is composed of galactose and glucose, while maltose from consists of two units of glucose that are joined with an α(1→4) glycosidic bond.

4 0
3 years ago
What is the subunit of proteins
Elan Coil [88]
The subunit of proteins is one protein molecule that assembles with more protein molecules to make a protein complex. 

Hope this helps! ;)
7 0
4 years ago
On a hot summer day, you notice a line of dark clouds forming. Based on this observation,
likoan [24]
Answer: D. Quantitative Observation.

Quantitative observation is the usage of your senses (smell, sight, touch, etc) or measurements to observe the results.
6 0
4 years ago
Which is one cause of speciation?​
faltersainse [42]

populations were prevented from interbreeding by geographic isolation

5 0
3 years ago
Other questions:
  • A nursing student is learning about henderson's theory. which of these statements by the student indicates effective learning?
    9·1 answer
  • Categorize The Items Correctly:
    6·1 answer
  • Are the bacteria that cause bad breath aerobes or anaerobes?
    13·1 answer
  • What areas of the work force can science be applied to?
    15·2 answers
  • What process allows water to enter the atmosphere?
    10·1 answer
  • "An experiment was performed to determine the role that ATP plays in kinesin movement along microtubules. Kinesin and microtubul
    11·1 answer
  • Name the three hormones and how they affect the body
    13·1 answer
  • Describe the benefit of the bilayer structure of the plasma membrane
    5·2 answers
  • TACTTAGAGGCACCACATGGGCCTTGCACT to mRNA
    12·1 answer
  • Which of the following does not provide genetic diversity?
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!