The oxygen needed for cellular respiration needs to be provided......acquired from breathing
Plastic can lead to the destruction of habitats and wildlife. In the ocean, many sea animals and birds are dying from choking on these toxins. It can take hundreds or even thousands of years to break down the plastic, causing the environmental damage to be long lasting.
<span>The correct answer is that he has injured one of the tendons or ligaments that help keep his knee in place, connecting it to the surrounding muscle and bone. As a result of this injury, his knee is no longer connected to the muscle and bone, thus it wobbled sideways when he started walking. He needs to go to a doctor immediately who can fix his knee so as to prevent further complications - he just needs his knee to be set in place again.</span>
Answer:
a. Inversion
b. Duplication
Explanation:
Inversion has the name suggest, has to do with a segment of DNA being reversed from end to end.
In this case here,
Inversion is taking place here.
species 1 ATGCAAATTTGGGCCCATGAATGGTTGCAA
species 2 ATGCAAAAATTTTGGTACGCCGAATGGTTGCAA
Therefore, the sequences in bold in species 1 are observed to be reversed end to end in species 2.
Deletion ❌❌
I am sure it's not feasible because deletion entails removal of a few sequences.
It can be seen that species 2 is longer than species 1, which gives another reason why deletion is not feasible too, as no sequences are seen to be deleted.
I believe duplication is feasible since AATT sequences are repeated once.
Our final answer,
inversion and duplication occur here.
Crude oil: Through drilling wells
Coal: Through surface and underground mining
Natural gas: Through hydraulic fracturing
