1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
DiKsa [7]
3 years ago
7

The four main spheres of the exterior of Earth are the _____. atmosphere, cryosphere, hydrosphere, and lithosphere anthrosphere,

atmosphere, cryosphere, and biosphere atmosphere, lithosphere, biosphere, and hydrosphere atmosphere, lithosphere, biosphere, and gemosphere
Biology
2 answers:
Liula [17]3 years ago
8 0

Answer: lithosphere (land), hydrosphere (water), biosphere (living things), and atmosphere (air).

Explanation: Hope this helps!!!

Nataly [62]3 years ago
6 0

The correct answer is C. Atmosphere, lithosphere, biosphere, and hydrosphere.

Explanation

Earth is a planet that belongs to the solar system. The earth is composed of several elements that constantly interact forming a system, that is to say, it is composed of interrelated and dependent parts, so if one of the parts changes, the others are modified, altering the entire system. The main parts of the Earth are its subsystems that are the lithosphere, the atmosphere, and the hydrosphere. These subsystems fulfill specific functions that allow the development of life on Earth. These subsystems are related. Each system has a particular function, the atmosphere contains oxygen and carbon dioxide; the hydrosphere contains all forms of water on earth, and the lithosphere is made up of mineral salts and support for living things. At the same time, these three subsystems allow the existence of the biosphere, that is, the subsystem referring to all forms of life on Earth. So, the correct answer is C. Atmosphere, lithosphere, biosphere, and hydrosphere.

You might be interested in
Populations with _______ are more likely to survive in different environments.
Klio2033 [76]
I believe it's B. That would be the best guess
8 0
3 years ago
Which best classifies milk of magnesia? <br><br> A. Acidic <br> B. Basic<br> C. Neutral
ira [324]
A I really hope this helped
8 0
3 years ago
Read 2 more answers
After the earthworm takes food in through its mouth, the food is temporarily stored in the
NeX [460]
C gizzard i think i dont truely know
6 0
3 years ago
The Increase of certain types of gases in the atmosphere has contributed to the problem of global warming. all these gases are
Aleks [24]
Fossil fuels and green house gases which burn holes in the ozone layer of the atmosphere causing global warming
4 0
4 years ago
Groundwater___?<br> Is recharged by precipitation
Blababa [14]

Answer: Ground water recharge includes recharge as a natural part of the hydrologic cycle and human-induced recharge, either directly through spreading basins or injection wells, or as a consequence of human activities such as irrigation and waste disposal. Artificial recharge with excess surface water or reclaimed wastewater is increasing in many areas, thus becoming a more important component of the hydrologic cycle.

Explanation:

https://www.sciencedirect.com/topics/earth-and-planetary-sciences/groundwater-recharge

8 0
4 years ago
Other questions:
  • What two factors determine the shape of protein?
    5·1 answer
  • A goiter is an enlargement of the thyroid gland that is associated with abnormal thyroid function. the worldwide incidence of go
    13·1 answer
  • BRAINLIESTTTTT ASAP!
    5·1 answer
  • What does this symbol represent
    5·1 answer
  • 5' ATGCCCGGGTGTCGTAGTTGA3' Complete the complementary sequence for the template strand
    5·1 answer
  • Food is NOT crucial for which of the following?
    10·2 answers
  • Identify the type of algae growing on Prospect Park Lake.
    14·2 answers
  • Which of the following statements are true about air?
    8·2 answers
  • Nhóm thức ăn nào sau đây giàu chất đạm?
    5·1 answer
  • Which of the following is used to describe DNA's double helix shape?
    6·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!