Are plants or animals unicellular?

2 answers:

4 0

Plants and animals are multicellular (which means many) and Unicellular means only one cell. Please mark as brainliest answer if it helped

anyanavicka [17]3 years ago

3 0

Plants are mostly unicellular, but neither of them are necessarily right. Plants and animals can be multicellular. Animals are mostly multicellular and plants are mostly unicellular. So plants. I hope this helps!

You might be interested in

4. Chargaff's research had shown that there are four monomers in DNA, in which two are always present in equal

viva [34]

Answer:

The monomers of DNA are individual nucleotides: cytosine, guanine, adenine, and thiamine, (A, T, C, G, respectively). Since DNA is a double-stranded molecule, each nucleotide has a match that chemically interacts with it to form nucleotide pairs

Explanation:

8 0

3 years ago

This is the greatest effect of the westernization and commoditization of culture.

ziro4ka [17]

The greatest effect of the westernization and commoditization of culture is that they created a global culture that allows competing marketers to drive down product costs. The answer to your question is A. I hope this is the answer that you are looking for and it comes to your help.

3 0

3 years ago

Read 2 more answers

Diagram of a dividing cell of an organism which has a diploid chromosome number of 4

Nata [24]

The type of cell division observed in the Figure is Meiosis. It can be deciphered by the presence of recombination between homo-logous chromosomes.

<h3>What is Meiosis?</h3>

Meiosis is a type of reductional cell division by which a cell produces four daughter cells having half of the genetic material.

Meiosis is a cell division that involves a genetic phenomenon known as recombination or crossing over.

Recombination refers to the exchange of genetic material between non-sister chromatids during Prophase I.

Learn more about meiosis here:

brainly.com/question/8253366

8 0

2 years ago

What do you think are the biggest advantages & disadvantages regarding the kind of technology we have access to in the early

ziro4ka [17]

Answer:

one among the biggest advantage of technology is increasing and improvement of living standard of people
and the biggest disadvantage of technology is unemployment because machines replaced human labor

5 0

2 years ago

I need to perform RNA transcription and translation on this strand of DNA, given that the mRNA is the opposite of this DNA stran

Anarel [89]

Well, basically when it says that the strand of mRNA is the opposite to DNA it means that the nitrogenous bases of DNA complement or follow base pairing rules to form the strand of mRNA.

In mRNA
A - U
G - C
T - thymine is absent and is replaced with U - uracil in mRNA.
The thymine bases in DNA are base paired with A - adenine in the mRNA strand.

So the mRNA strand would be the following :

AUGUGGGCUACGCGAGCUUCAUACGAUCUAGCUACGCAGUGGCAGCAGGCAUCACAUCGAUCGCAUUAG.

So, now that we know that this is the mRNA strand, and assuming that the top or the first part is the 5' region and the final end of the mRNA is the 3' region

Group three 3 nucleotides together in the mRNA strand and find the amino acid that the first 3 would represent in this case AUG would represent the start codon or methionine in this case it would be the start, the next would be UGG, etc, do this until you reach the final set of 3 nucleotides and the final product would be a protein consisting of whatever other amino acids were represented by the codon or 1 set of 3 nucleotides on the mRNA strand.

4 0

3 years ago