1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Charra [1.4K]
2 years ago
15

What is answer from the periodic table please help very urgent due today ​

Chemistry
2 answers:
Alex73 [517]2 years ago
7 0

Answer:

4

Explanation:

You know this by looking at the number of protons and electrons which represents the atomic number.

Sindrei [870]2 years ago
5 0

Answer:

4 electron/proton

Explanation:

in first shell it has 2 electron

then in second shell it has 2 electron also

so add them together we get 4

You might be interested in
Mass is measured against a standard by using a balance. <br> a. True<br> b. False
jok3333 [9.3K]
Mass is measured against a standard by using a balance. The statement given above is a fact. Therefore the answer among the choices is letter "A" or "A. True". I hope this helps you on your assignment. 
6 0
3 years ago
Read 2 more answers
How is a wound healing a chemical change? please explain ​
masya89 [10]

Answer:

its because fibrinogen is a chemical substance that builds up at the wound and gets hard by the action of air to prevent bleeding

5 0
2 years ago
Read 2 more answers
Why is the bond angle in a water molecule less than the bond angle of methane
Annette [7]
The bond angle in the Water Molecule is approx. 104.5 degrees. The methane molecule is approx. 109.5 degrees. The differences, is due to the force from the surrounding molecules and atoms. For example the Lone pairs of electrons.

6 0
3 years ago
How many grams of oxygen are produced when 3.0 moles of potassium chlorate decompose completely?
Elena-2011 [213]
ሠረዕጎነዘሠጋዕጕነጋሠሀነዘነጋዕዘቿዘነዘ :)
4 0
2 years ago
What is a model that is used to predict possible genotypes and phenotype of offspring?
frutty [35]
This is called the pedigree chart.
7 0
2 years ago
Other questions:
  • Plaster casts, CaSO4 Spell out the full name of the elements in alphabetical order separated by commas.
    10·2 answers
  • A liquid does not have a constant boiling point, but it looks the same throughout. the liquid is probably a
    10·1 answer
  • Is there any way to predict the exact location of any one marble drop on the target?
    5·1 answer
  • I need help plz this is driving me crazy
    6·1 answer
  • If you wanted to buy an aquarium with only benthos in it which of the following would you buy
    11·1 answer
  • Consider the following standard reduction potentials: Zn2+(aq) + 2 e− LaTeX: \longrightarrow⟶ Zn(s) Eo = −0.76 V Mg2+(aq) + 2 e−
    6·1 answer
  • Lens coating are made of A.teflon B.bakelite C.melamine D.PVC
    7·1 answer
  • Which term describes a consumer that eats both plants and animals? A. carnivore B. herbivore C. omnivore D. producer
    7·2 answers
  • Write the pair sequence using the right base for the mouse DNA. ATGGGTGATGTTGAAAAAGGCAAGAAGATTTTTGTTCAGAAGTGTGCCCAGTGCCACACT
    5·1 answer
  • Seriously need help with this!!<br> (〒﹏〒)(〒﹏〒)<br><img src="https://tex.z-dn.net/?f=%20%5C%3A%20%20%5C%3A%20%20%5C%3A%20" id="Te
    8·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!