1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Amanda [17]
3 years ago
10

The CNS is vulnerable. There are several systems and structures in place which protect these vital tissues. How is the brain and

CNS protected? What structures exist and how does each help protect? You should be able to choose at least 3.
Biology
1 answer:
V125BC [204]3 years ago
5 0

Answer:

1) Skull and Vertebral column

2) Meninges

3) Cerebrospinal fluid.

Explanation:

Central Nervous system:

CNS is the abbreviation of Central Nervous system. CNS controls the whole body functions so it is the most important component of the body. CNS consist of two parts 1) Brain and 2) Spinal cord

Both of these organs are very important and hence need to be protected. Nature provided these organs with certain protective mechanisms these includes

1) Skull and Vertebral column:

Skull is present around brain and vertebral column is present around spinal cord. These structure provides mechanical support to soft parts of CNS.

2) Meninges:

These are the membranes that provide antiseptic environment to the brain and hence protect it from microbes and other harmful substances.

3) Cerebrospinal fluid:

This fluid is present inside meninges which nourishes the brain and protect it from mechanical stresses.

You might be interested in
In humans, the inheritance of what is best explained as being codominant
ArbitrLikvidat [17]

Answer:

height

Explanation:

7 0
2 years ago
Predict which species of finch would be most likely to survive if the weather on the galapagos islands gradually chamged and the
krek1111 [17]
<span>Predict which species of finch would be most likely to survive if the weather on the Galapagos Islands gradually changed and the seeds available to the finches became larger with heavier coverings.

Answer: The </span><span>species of finch that would be most likely to survive are </span>Large Ground Finches because they have big, thick beaks to break the seed-heavy coverings.
4 0
3 years ago
Volume can be measured in:<br> A.centimeters<br> B.square centimeters<br> C.cubic centimeters
Basile [38]
Cubic centimeters is the answer
3 0
3 years ago
Read 2 more answers
A quote from Carl Sagan " The history of life can be described as the gradual dominance of brains over genes" WHAT DID HE MEAN B
Igoryamba
He means its more then just what your genes give you its what you can overall think of
4 0
3 years ago
Describe the relationship between gravitational force and distance as shown in the diagram below. SC.6.P.13.2 ​
satela [25.4K]

Let's see the formula

\\ \sf\longmapsto F=G\dfrac{Mm}{r^2}

  • r is the distance
  • G is gravitational constant
  • M is mass of earth
  • m is mass of object.

Hence

\\ \sf\longmapsto F\propto \dfrac{1}{r}

  • If distance is more force is less .
  • If distance is less force is more.
8 0
2 years ago
Other questions:
  • Frances puts a hungry rat into an experimental chamber. whenever the rat presses a lever, food falls into a tray. in about 30 mi
    6·1 answer
  • What is the first 25 cm of the small intestine called?
    11·1 answer
  • ANSWER I WILL MAKE YOU THE BRAINLIEST Organisms can reproduce sexually or asexually. There are important differences between the
    8·2 answers
  • Both DNA and RNA contain a five-carbon sugar. This sugar is
    7·2 answers
  • In a field study by Shultz and his colleagues (2007),several households in a neighborhood received weeklyfeedback about their le
    11·1 answer
  • PLEASE HURRY 10 PTS AND BRAINLIEST IF RIGHT
    14·2 answers
  • Scientists at the tar pits discovered that many of the smaller animals they extracted from the pits still exist around Los Angel
    15·1 answer
  • Say you had the following DNA sequence: ATGCTGCGAAACTTTGGCTGA Let's say there was a mutation that removed one letter (the first
    5·1 answer
  • Disinfection is important in killing any remaining bacteria or pathogens in the wastewater. True False
    12·1 answer
  • A plant is growing near edge of a forest grows best when it gets a large amount of sunlight. If a forest fire occurs and burns d
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!