1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Fiesta28 [93]
3 years ago
10

The movement of ocean currents around the globe? Check all that apply. Strong winds force warm water to sink to the ocean floor.

The Coriolis effect causes warm and cold water to mix. Cool dense water sinks to the ocean floor. Warm water replaces cool surface water. Wind blowing parallel to the shore causes upwelling of cool water.
Biology
1 answer:
zysi [14]3 years ago
3 0

Answer:

Cool dense water sinks to the ocean floor.

Warm water replaces cool surface water.

Wind blowing parallel to the shore causes upwelling of cool water.

You might be interested in
Say you had the following DNA sequence: ATGCTGCGAAACTTTGGCTGA Let's say there was a mutation that removed one letter (the first
Elden [556K]

Answer:

Codons after the mutation are not exactly the same as before mutation, because one base was deleted, changing the sequence of codons.

Codons before mutation:  ATG   TGC   GAA   ACT   TTG   GCT

<em>Only the first one (ATG) might coincide with one of the codons before mutation. </em>

Explanation:

Genetic information for the aminoacids assembly during the protein synthesis is stored in short sequences of three nucleotides named codons in the DNI or mRNA. Each of the codons represents one of the 20 amino acids used to build the protein. There are a total of 64 codons. 61 codify amino acids, one of these amino acids is also the start point of protein synthesis, and the left three codons are stopping translation points.

The Sequence before mutation ATGCTGCGAAACTTTGGCTGA

Codons: ATG   CTG   CGA   AAC   TTT   GGC   TGA

The Sequence after mutation ATGTGCGAAACTTTGGCTGA

Codons: ATG   TGC   GAA   ACT   TTG   GCT

<em>Only the first one (ATG) might coincide with one of the codons before mutation. </em>

4 0
3 years ago
What would happen if you wouldn't do experiments in science
Lady bird [3.3K]
You would do book work like every other day
3 0
3 years ago
When ATP breaks off the third phosphate group, it is converted into __________.
jasenka [17]
I think its ADP because it breaks off the third phosphate. 
4 0
3 years ago
Read 2 more answers
WHAT ARE THE DIFFERENCES BETWEEN TEMPORARY AND PERMANENT CHANGE
Masteriza [31]
The difference between temporary and permanent is temporary will only last a little while, permanent on the other hand lasts forever
7 0
3 years ago
Read 2 more answers
Genetic drift is dependent upon which of the following? A. crossing-over B. random chance C. natural selection D. gene mutation
sammy [17]

C. natural selection.

This is because in smaller populations the more that two separate groups of animals don’t interbreeding the father they become until speciation occurs where they cannot interbreed between the two groups.

7 0
3 years ago
Read 2 more answers
Other questions:
  • Water can "defy gravity" and climb uphill true or false
    12·2 answers
  • Biology Question!
    10·2 answers
  • The statement, "All plants and animal tissue is made up of tiny units," is known as the what?
    12·1 answer
  • Explain how genes are expressed for a particular<br> trait.<br> DONE
    5·1 answer
  • Why is It Important for a cell to preform checks after DNA replication
    14·1 answer
  • Please help meeeeeeee is this correct
    13·2 answers
  • Why don't consumers receive 100% of the energy from the organisms they consume?
    7·1 answer
  • Glycogen, starch, and cellulose are examples of​
    15·1 answer
  • What is not a characteristic of a pioneer species
    5·2 answers
  • The transfer of genes from parents to their offspring is known as *
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!