1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
horsena [70]
3 years ago
12

How food wastage contribute to loss of energy and global warming?

Biology
1 answer:
victus00 [196]3 years ago
4 0
We grow the vegetation and we get our oxygen from plants and vegetation.
You might be interested in
Is photosynthesis only found in plants?
Lapatulllka [165]

Answer:

yes, because photosynthesis requires chlorophyll, which is only in plants.

Explanation:

6 0
3 years ago
Read 2 more answers
What environmental disaster can be attributed to over-population and over-use of resources by humans?
Damm [24]
Pollution in pretty sure
8 0
3 years ago
Which is true about scientific knowledge?
Neporo4naja [7]
TB. It is open to change.he thing about science is that a discovery may be made today and written up but by tomorrow something else is found that edifies what was found or proves it incorrect or make it obsolete.  .Therefore the answer is <span>B. It is open to change</span>
5 0
3 years ago
A forest fire lightly burned part of the park. The fire added nutrients to the soil. The fire also helped pine cones open and dr
sdas [7]
It is defiantly not a, because only part of the park was burnt. It wouldn't be c, because fire does not cause seeds to fly in. I would say B
8 0
3 years ago
Read 2 more answers
The cell plate is formed during ...
elena55 [62]

\huge\mathfrak {Answer}

During telophase, membrane-enclosed vesicles derived from the Golgi apparatus migrate to the center of the cell where the metaphase plate used to be and fuse to form a cell plate. Eventually, the growing cell plate fuses with the existing plasma membrane, producing two daughter cells, each with its own plasma membrane.

Thanks

4 0
3 years ago
Other questions:
  • The sequence of coding strand of a DNA molecule is given below. Assume that it is read from left to right. CCTACCTTATGCCAAGTTGGG
    15·1 answer
  • BRAINLIESTTTT ASAP!!!!!!
    8·2 answers
  • If you were studying the effects of climate change on the geographic ranges of species living in the mountains and your climate
    6·1 answer
  • A beer-making microbiologist noticed that no matter how long the brewing process took, 3% alcohol was the maximum produced. Hypo
    12·1 answer
  • How did the artificial selection practiced by pigeon breeders influence Darwin's theory of evolution by natural selection?
    8·2 answers
  • How did life on earth become so diverse?
    13·1 answer
  • Need help with this please help
    9·2 answers
  • Which food chain represent one way that energy my flow through this ecosystem?
    6·2 answers
  • Please help!!!!!!!!!!!!
    8·1 answer
  • Help plz:
    6·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!