1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
NeX [460]
3 years ago
15

Please help me out with this

Biology
2 answers:
Volgvan3 years ago
6 0

Image 1 -

The carrying capacity is just as the name suggests, the maximum number of individuals that can make up a population.

Why are the others wrong?

Migration might change the carrying capacity, depending on where the species go, it can increase or decrease, but it's not the only way. A - Wrong.

It can actually be for any type of species, no matter what their distribution type is. B - Wrong.

The survivorship patter doesn't actually matter, and it really doesn't have much to do with the carrying capacity. C - Wrong.

It can vary from population to population, depending on their reproduction rate and their location (amount of resources available). D - Wrong.

Why is E. right?

It's the only one that provides us with truthful information, in a way that makes sense. If enironmental conditions change, it might not affect a population directly.

Let's say, it's a dear population. If it gets too cold, the plants they feed on might die, and they will not have food, but the cold isn't affecting them directly - they will not die because of the cold itself, but because of what the cold will do to their food.

Answer:

E.

___________________________________________________

Image 2 -

The growth pattern we see is called logistic growth - the population grows until the carrying capacity and then stabilizes.

Since they give us a chart with a logistic growth, basing oursefls on the definition above, the limit of the growth line will be the carrying capacity of the population, therefore, 2000.

Answer:

200.

Hope it helped,

BioTeacher101

Semenov [28]3 years ago
4 0

Image 1: correct answer is

<u> E. may change as environmental conditions change</u>

⭐⭐⭐⭐⭐⭐⭐⭐⭐⭐⭐⭐⭐⭐⭐⭐⭐⭐⭐⭐⭐⭐⭐⭐⭐⭐⭐⭐⭐⭐⭐⭐⭐⭐⭐⭐⭐⭐

Image 2: correct answer is

<u>2000</u>

.....................................................

For proof I got them correct!!

You might be interested in
How many chromosomes are in a typical human body cell?
dybincka [34]

Answer:

46 chromosomes

Explanation:

There are 46 chromosomes in a typical human body cell. (23 pairs of chromosomes)

7 0
2 years ago
An established 47 year-old patient presents to the provider's office after falling last night in her apartment when she slipped
Bezzdna [24]
Does anyone know the answer
6 0
3 years ago
Read 2 more answers
The function of antibodies is to A. inject toxins into living pathogens. B. mark pathogenic cells for destruction. C. act as Tol
Liono4ka [1.6K]

Answer:

Mark pathogenic cells for destruction. (Ans. B)

Explanation:

Antibodies are generated by the plasma cells, and once these secreted, they attach quickly to the surface of the toxin and stop the toxin from infecting the normal body cell by blocking key extracellular sites.

Antibodies also help to mark pathogens for destruction by the help of macrophages or neutrophils and they are known as phagocytic cells because they are highly excited to macro-molecules complexed with antibodies.

6 0
3 years ago
If there is less space for natural ecosystems, then _____ may happen to plants and animals living in those ecosystems. *
oee [108]
The answer is excision
6 0
2 years ago
If RNA strand reads AUG CGU AAU UAU, what did its source DNA read?
borishaifa [10]

Answer:

TAC GCA TTA ATA

and apparently my answer needs to be 20 charcters long

6 0
3 years ago
Other questions:
  • Hypothesis: Increasing water temperature had no effect on the fermentation rate of yeast. Experiment: Compared yeast in room-tem
    12·1 answer
  • Gaylord ____ is the founder of earth day, which began in 1970
    8·1 answer
  • A group of fibers inside the cell that helps support the cell is the _____. microtubule flagella cytoskeleton filament
    11·1 answer
  • When attempting to lower a person's body temperature in response to hyperthermia?
    9·1 answer
  • Which of the following actions has an effect on the environment: A Turning lights on in your home B Building a new road C All of
    10·1 answer
  • What is the relationship between water clarity and kelp productivity?
    12·1 answer
  • What are three characteristics of scientific ideas?
    10·1 answer
  • What was Dr. Kearns original problem?
    10·1 answer
  • 5' ATGCCCGGGTGTCGTAGTTGA3' Complete the complementary sequence for the template strand
    5·1 answer
  • I have Please I need help now there is a lot of points so please help me!!
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!