1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
vovangra [49]
3 years ago
12

Which two animals is the tiger most closely related to

Biology
1 answer:
Dominik [7]3 years ago
4 0
The lion and bobcat......
You might be interested in
Which parts do BOTH animal and plant cells have?
IRISSAK [1]

Answer:

They both contain membrane-bound organelles such as the nucleus, mitochondria, endoplasmic reticulum, golgi apparatus, lysosomes, and peroxisomes.

Explanation:

5 0
3 years ago
Read 2 more answers
True or false chloroplasts are never found in animal cells
-Dominant- [34]
The answer is True

I hope that helped
6 0
3 years ago
What meiotic process, relative to the number of chromosomes of a given species, accounts for a significant amount of genetic var
Gnoma [55]
Prophase 1 of meiosis <span>relative to the number of chromosomes of a given species, accounts for a significant amount of genetic variation in gametes.</span>
8 0
3 years ago
Read 2 more answers
Which of the following defines a genome?
zhenek [66]
The options that are incorrect are A) representation of a complete set of a cell's polypeptides, B) the complete set of an organism's polypeptides, C) the complete set of a species' polypeptides, and D) karyotype, which makes E) the complete set of an organism's genes the correct answer to what defines a genome.
7 0
3 years ago
What are mushrooms classified as
timofeeve [1]
Mushrooms are fungi. 
8 0
3 years ago
Other questions:
  • Explain why bacteria are important in the nitrogen cycle
    7·1 answer
  • Which domain does sulfolobus belong to​
    12·1 answer
  • Low genetic diversity _____. helps a population evolve can result in extinction is not a problem with modern-day organisims is t
    6·2 answers
  • Biotic factors cannot live without abiotic factors. True or false
    11·2 answers
  • Which of the following parts of the plant facilitates photosynthesis?
    12·2 answers
  • Need mRNA <br> AMINO ACIDS <br> 1.AATACGGGGGCGTAACCACTA<br> 2. GCTAGTACGTGCACATTAGAA
    5·1 answer
  • Explaining hardy Weinberg equilibrium and the eastern squirrel/ how many in the population have the following genotypes
    6·1 answer
  • Which biome does this photograph represent?
    12·2 answers
  • Which of the following are NOT roles that zygomycota play in our ecosystem? Select all that apply.
    14·2 answers
  • Medicine is an example of pure science.<br> True<br> False
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!