1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
VikaD [51]
3 years ago
10

_________is associated with preventive care and the use of audiovisual equipment through which the patient and the care provider

or healthcare professional can connect remotely.
Biology
2 answers:
Yuri [45]3 years ago
5 0

Telehealth, an assembly of resources or series of approaches intended for improving health care, public health, and health instruction distribution and maintenance with the use of telecommunications machineries. Telehealth includes a wide variety of equipment and strategies to distribute virtual medical, health, and educational amenities.

JulsSmile [24]3 years ago
3 0

Answer:

Tele Health

is associated with preventive care and the use of audiovisual equipment through which the patient and the care provider or healthcare professional can connect remotely.

Explanation:

Telehealth is the are of the health sciences that thanks to the employment of information and communication technologies helps the user access any division of the health sciences to receive assistance. It could be informative, demonstrative, or even practicing. However, intervention is limited due to the physical capabilities of the technology. Nevertheless, robots will help to satisfy that absence. Telehealth is the are of the health sciences that thanks to the employment of information and communication technologies helps the user access any division of the health sciences to receive assistance. It could be informative, demonstrative, or even practicing. However, intervention is limited due to the physical capabilities of the technology. Nevertheless, robots will help to satisfy that absence.

You might be interested in
Which response represents the potential risks of a biohazard exposure to the facial mucous membranes of the eyes, nose, or mouth
Assoli18 [71]

When exposed to the mucous membranes on the face, biohazards can contaminate the eye as well as enter the circulation and stomach.

  • Biological compounds that endanger the health of living things, particularly humans, are referred to as biohazards, sometimes known as biological hazards.
  • Medical trash or samples of microorganisms, viruses, or toxins (from a biological source) that may be harmful to human health are examples of biohazards.
  • Bacteria, viruses, parasites, and molds or fungi are examples of biological health risks.
  • When they come into touch with skin, are eaten, or are inhaled, they can be harmful to human health.
  • They have the potential to spread diseases such parasite infections, tetanus, lung infections, and food poisoning.
  • The method via which a person can come into touch with a dangerous material is referred to as an exposure pathway. There are three primary exposure routes: direct touch, ingestion, and inhalation.

learn more about biohazards here: brainly.com/question/28060388

#SPJ4

3 0
1 year ago
The human immunodeficiency virus (hiv) that causes the disease known as aids selectively infects ________ cells.
Furkat [3]

The human immunodeficiency virus (HIV) that causes the disease known as aids selectively infects helper T cells (CD4+).

This retrovirus also infects macrophages and dendritic cells. When CD4+ T cell numbers decrease below a critical level (due to the killing of this cells with different mechanisms), cell-mediated immunity is lost. As a result, the body becomes progressively more susceptible to infections, leading to the development of AIDS.

<span> HIV can be transmitted only via body fluids like blood, semen, pre-seminal fluid, rectal fluids, vaginal fluids, and breast milk, which means that people usually get or transmit HIV through sexual behaviours and use of the needle. For HIV infection, these fluids must come in direct contact with a mucous membrane or damaged tissue. Another way is to be directly injected into the bloodstream (from a needle for example).</span>

7 0
3 years ago
16. The genetic variation that leads to evolution can occur when genes from
Art [367]
C. natural selection
6 0
2 years ago
Read 2 more answers
Which of the following defines an ecological succession
miv72 [106K]

Answer:Ecological succession is the process that describes how the structure of a biological community (that is, an interacting group of various species in a desert, forest, grassland, marine environment, and so on) changes over time. The structure of this community becomes more complex as new species arrive on the scene.

Explanation:

4 0
2 years ago
What do I do for #16 ?
Pepsi [2]
You find the mRNA code complementary to the strand of DNA .
A T G G C T C A A G C T I'm pretty sure
4 0
3 years ago
Other questions:
  • What are cells that can become any other cell type called
    8·1 answer
  • ABO blood type is examined in a Taiwanese population, and allele frequencies are determined. In the population,
    12·1 answer
  • The lakes of northern Minnesota are home to many similar species of damselflies of the genusEnallagma. These species have appare
    9·1 answer
  • Which activity helps the body maintain homeostasis?
    12·2 answers
  • Please help with the answer
    7·1 answer
  • A gene carries the ________ for a trait.
    11·1 answer
  • What two forces are balanced when a system is in isostasy?
    9·1 answer
  • Who is to blame climate change?
    7·1 answer
  • The tRNA for GUCAUCGAUCGAUCGGAUGCC
    11·1 answer
  • 1. What is facial reconstruction? Why is it used?
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!