1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
givi [52]
3 years ago
11

What is the composition of a simple fat?

Biology
2 answers:
Leni [432]3 years ago
7 0
Fatty acid and Glycerol
Illusion [34]3 years ago
6 0

Answer:

Simple fats, also known as Acylglycerides or neutral fats, are those that are composed of esterified Glycerol (ester formation) by one, two or three fatty acids, in which case we talk about: monoacylglyceride, diacylglyceride or triacylglyceride respectively. Example types of them are oils, lard and tallow.

You might be interested in
How to sold equation with periodic table of elements?​
skelet666 [1.2K]

In order to balance the chemical equation, you need to make sure the number of atoms of each element on the reactant side is equal to the number of atoms of each element on the product side. In order make both sides equal, you will need to multiply the number of atoms in each element until both sides are equal

5 0
3 years ago
All the populations of organisms living close enough together for potential interaction make up __________.
rosijanka [135]
All the populations of organisms living close enough together for potential interaction make up a community!
7 0
3 years ago
Read 2 more answers
A triple beam balance is shown below. Select the part of the triple beam balance that is held when carrying the balance from pla
geniusboy [140]
 i cant see the picture sorr.

4 0
3 years ago
Who was A.F.A king ? ​
MariettaO [177]

Answer:

Albert Freeman Africanus King (18 January 1841 – 13 December 1914) was an English-born American physician who witnessed the assassination of Abraham Lincoln on 14 April 1865. He was a bystander physician who was pressed into service during the assassination.

5 0
2 years ago
Why is it that although single myosin molecules have a polarity, the myosin in thick filaments is
aliya0001 [1]
Polarity of a molecule does not involve the symmetry of the molecule rather it deals on with the presence of net charges and partial charges. It would be due to the partial charges present in the <span>single myosin molecules that causes its polarity. Hope this helps. Have a nice day.</span>
5 0
3 years ago
Other questions:
  • Primate females:
    11·1 answer
  • If a DNA molecule is 22% adenine in any organism, which percentage of thymine will that DNA molecule contain?
    11·1 answer
  • A boy drops an ice cream cone on a cement sidewalk on a hot, sunny day. The ice cream begins to melt soon after hitting the side
    15·1 answer
  • Which organ systems help deliver oxygen to body cells?
    12·2 answers
  • A homeostatic imbalance that activates these bone cells would lead to a loss of bone density. True or False
    13·1 answer
  • in grammatically correct sentences, trace the large of the products of photosynthesis as they exit the leaf
    8·1 answer
  • What is a neap tide? What causes a neap tide?
    6·1 answer
  • The tRNA for GUCAUCGAUCGAUCGGAUGCC
    11·1 answer
  • Describe the processes by which root hair cells absorb water and mineral ions from the soil
    12·1 answer
  • Which describes how
    13·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!