1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
padilas [110]
3 years ago
11

Which phrase best describes a rock? A. a chemical arranged in a lattice B. a gabbro of minerals C. a mixture of crystals D. a fi

re-formed crystal PLZ AWNSER
Biology
2 answers:
jarptica [38.1K]3 years ago
7 0
The answer is B because :
A=<span>The oppositely-charged ions are arranged in a regular way to form a giant ionic lattice. It is a 'lattice' because the arrangement is a regular one and 'giant' because the arrangement is repeated many times with large numbers of ions. Ionic compounds often form crystals as a result.
B=</span><span>Gabbro is a dark, medium- to coarse-grained intrusive igneous rock composed of calcium plagioclase, pyroxene, and minor olivine, but no quartz. It is the intrusive equivalent of a basalt.
C=</span><span>The crystallization of an organic compound can produce a mixture of crystalline solids with different solid-state structures (polymorphs).[1] No convenient method now exists to separate crystals of a single polymorph from a mixture of crystals of different polymorphs.
D= a fire formed crystal and that is not a rock.
</span>
Rufina [12.5K]3 years ago
5 0
Hi there :)


I would go with B. a gabbro of minerals.



Sorry if its wrong

-Take Care Now-
`Ans~
You might be interested in
In some coastal areas, the air temperature is high throughout the day. There is often precipitation in the late afternoon. Which
kondor19780726 [428]
B. Rain hope I helped
5 0
3 years ago
Why is the process of DNA replication essential to a cells<br> preparation for division?
mr_godi [17]

Answer:

Nothing

Explanation:

lol

3 0
2 years ago
Read 2 more answers
If the two oligonucleotides are allowed to anneal and the DNA polymerase and all substrates (4 dNTPs, etc.) are added to the mix
Lorico [155]

Answer:

d. T

Explanation:

For a given DNA sequence, the array is represented as:

5'ATCCTGGACACTGTACCATCGGTACCAATCACAGGTCCTTACAGT 3'

And the premier; 5' GGACCTGTGA 3' attaches to the complementary base on the DNA sequence.

i.e.

5'ATCCTGGACACTGTACCATCGGTACCAATCACAGGTCCTTACAGT 3'

*AGTGTCCAGG

Thus, the first nucleotide that will be incorporated into the DNA will be T

5 0
3 years ago
In some large groups of plants, including dandelions, oaks, and willows, the biological species concept is complicated because t
Ber [7]

Answer:

A) hybridization; morphospecies

Explanation:

The biological species concept is the concept which can define a species as an individual of a large population which can interbreed and produce an offspring in a population. The concept was given by Ernst Mayr.

Morphospecies refers to the species which can be characterised by the differences in their morphological features like in the Oak, willows and the dandelions.

The biological species concept is not valid or complicated in the case of the morphospecies like in the Oak, willows and the dandelions as the individuals of these three population can exchange their genes through the process of hybridization.

Thus, Option-A is the correct answer.

3 0
3 years ago
The genome of the bacterium Neisseria gonorrhoeae consists of one double-stranded DNA molecule that contains 2220 kilobase pairs
qwelly [4]

Answer:

The length of the DNA of the Neisseria gonorrhoeae is 2220 kbps. It is to be noted that 1 kbp = 1000 bases. After converting the kbps into base pairs we get:  

2200 * 1000 = 2220000 base pairs

The entire length of the base pairs is,

2220000 * 0.34 nm = 754800 nm

After converting it into centimeters we get:  

754800 * 10^-7 = 0.7548 cm

Therefore, the total length of the molecule of DNA is 0.7548 cm.  

The 85 percent of the 2220000 base pairs = 2220000 * 85 / 100  

= 188700000 / 100 = 1887000 base pairs

Each of the amino acid is encrypted by three base pairs (triplet codon)

Thus, the number of bases needed to generate a protein with 300 amino acids is 300 * 3 = 900 base pairs

The number of protein encoding genes in N. gonorrhoeae genome is :  

= 1887000 / 900 = 2096.6 or 2097

Hence, the total number of protein encoding genes present in the genome of N. gonorrhoeae is 2097.  

The left 15 percent genes can be considered as the non-coding genes. They exhibit the information essential to monitor the expression of the 85 percent genes.  

5 0
3 years ago
Other questions:
  • Summarize the case of the Atlantic cod. In your response, specifically address the following points:
    5·1 answer
  • You are on the scene of a person down. you arrive at a college dormitory and find a 21-year-old patient lying supine on the floo
    5·1 answer
  • This lake was formed by melting ice that came from an ancient A) ocean. B) glacier. C) ice berg. D) snow storm.
    11·2 answers
  • Help!! i can’t fail this class
    9·1 answer
  • What changes can occur in an aquatic ecosystem as a result of neutrient loading?
    7·1 answer
  • Who is responsible for the sex of the offspring male or female .why?
    13·2 answers
  • How do spores survive even after the plant has died?
    9·1 answer
  • How does the sperm come in contact with frog eggs?
    15·2 answers
  • 2. How does temperature change in the troposphere?
    10·2 answers
  • What will most likely cause a sudden wind to start blowing? Clouds Humidity Precipitation Air pressure
    9·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!