Answer:
Explanation: Human approach, attitudes and adherence to the safety skills does deal with the impact over environmental factors at a personal level. We have to be more careful and cautious while we pursue our own habits, and activities, with the aim of posing less harm to the environment in any way.
This is the structure of DNA and nucleotide is the phosphate group with sugar (the pink one ) and base that are 4 different bases : A, T, C, G and between these bases we have hydrogen bonds and you can see that always it like : C≡G
A=T :))) i hope that helps :)))https://www.google.com/url?sa=i&rct=j&q=&esrc=s&source=images&cd=&cad=rja&uact=8&ved=0ahUKEwiawYOO7-...
In C4 plants, photosynthesis is compartmentalized into two; light-dependent stage and light independent stage. The light-dependent stage occurs in the mesophyll cells of the leaf. Here, CO2 is fixed into oxaloacetate by PEP carboxylase enzyme. The oxaloacetate is then converted to malate that is then transported to bundle-sheath cells (around the leaf veins). The CO2 is then released from the malate and the gas molecule is subsequently fixed by RuBiSCO like in C3 plants. The biggest advantage of C4 photosytheis is that the wasteful process of photorespiration is greatly reduced.
Answer:
Elements that are found in the same horizontal row (belong to the same period) in the periodic table, e.g. Fluorine and Neon both have the same energy level of 2.
<em>Note: The question does not specify any two elements.</em>
Explanation:
The modern periodic table is organized into eight vertical columns known as groups and seven horizontal rows known as periods. The atomic number ( number of protons in the nucleus) of elements increases when moving across the periodic table from left to right. The horizontal rows or periods represents an energy levels or the number of electron shells in an element. Energy levels (also called electron shells) are fixed distances from the nucleus of an atom where electrons may be found. Elements belonging to the same period have the same number of energy level or shells. For example, the elements belonging to Period 2 include lithium, beryllium, boron, carbon, nitrogen, oxygen, fluorine and neon. These all have the same number of energy level of 2.
Answer:
a. Inversion
b. Duplication
Explanation:
Inversion has the name suggest, has to do with a segment of DNA being reversed from end to end.
In this case here,
Inversion is taking place here.
species 1 ATGCAAATTTGGGCCCATGAATGGTTGCAA
species 2 ATGCAAAAATTTTGGTACGCCGAATGGTTGCAA
Therefore, the sequences in bold in species 1 are observed to be reversed end to end in species 2.
Deletion ❌❌
I am sure it's not feasible because deletion entails removal of a few sequences.
It can be seen that species 2 is longer than species 1, which gives another reason why deletion is not feasible too, as no sequences are seen to be deleted.
I believe duplication is feasible since AATT sequences are repeated once.
Our final answer,
inversion and duplication occur here.
