1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Vlad1618 [11]
3 years ago
10

Explain why the tetraphenylcyclopentadienone is in deep purple color? Explain why the tetraphenylcyclopentadienone is in deep pu

rple color? friends, please help me out thanks
Biology
1 answer:
NikAS [45]3 years ago
4 0
<span>Tetraphenylcyclopentadienone has five conjugated aromatic rings. Its structure suggests that it is highly conjugated. With this structure, it absorbs the energy from wavelengths of colors other than violet and reflects the energy from violet wavelengths.</span>
You might be interested in
A student does an experiment for a science fair to study whether temperature affects the timing of a cricket’s chirps. The stude
Hitman42 [59]
If the experiment was done correctly, it should be the number of crickets exposed to each different temperature.
3 0
3 years ago
Read 2 more answers
Interphase must occur once before meiosis can happen. (Same thing for mitosis). What would happen if interphase didn’t occur fir
Olenka [21]
During interphase DNA is copied. So if there was no interphase, the new cells wouldn't have enough DNA.
7 0
3 years ago
Genotype describes the specific genetic characteristics of a living thing and cannot be __________________. Phenotype describes
Gnom [1K]

Answer:

that cannot be changed because of it dominancy

5 0
3 years ago
15. Explain how each of the following creates electrical energy:
olga_2 [115]
Solar- technologies convert sunlight into electrical energy either through photovoltaic panels or through mirrors that concentrate solar radiation.

Hydro- a hydraulic turbine converts the energy of flowing water into mechanical energy. A hydroelectric generator converts this mechanical energy into electricity

Tidal- energy is a form of hydropower that works by harnessing the kinetic energy created from the rise and fall of ocean tides and currents, also called tidal flows, and turns into unusable electricity

Wind- turns the propeller like blades of a turbine around a rotor, which spins a generator, which creates electricity

OTEC- plants pump large quantities of deep cold seawater and surface seawater to run a power cycle and produce electricity

Biomass- is burned in a boiler to produce high-pressure steam. This steam flows over a series of turbine blades, causing them to rotate. The rotation of the turbine drives a generator, producing electricity

Geothermal- power plants use steam to produce electricity. The steam comes from reservoirs of hot water found a few miles or more below the earth’s surface. The steam rotates a turbine that activates a generator, which produces electricity
4 0
3 years ago
Translate the mRNA of the above (Question 2) transcription. ... 3' tcgccctactcgcgtacaccgcgtattgac 5' turns into:
Kryger [21]

agcgggaugagcgcauguggcgcauaacug
4 0
3 years ago
Other questions:
  • While sitting in class, sherman suddenly experiences a racing heart, clammy hands, dizziness, and shaking. sherman has many of t
    9·1 answer
  • Which example best represents the adhesion, cohesion, and surface tension of water?
    14·1 answer
  • WILL GIVE THE BRAINLEST <br><br>Explain why the answer you chose is correct.​
    15·1 answer
  • Charles darwin's theory
    12·1 answer
  • In fall, chlorophyll is the first pigment to disappear from dying leaves? Using what you have seen today, and specific vocabular
    13·2 answers
  • Which of the following factors would LIMIT carrying capacity?
    10·1 answer
  • Ill give you a brainliest if it is right
    14·1 answer
  • The thin external covering is similar to the
    8·1 answer
  • Which of the following is not a step involved in critical thinking?
    10·1 answer
  • 1
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!