1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
beks73 [17]
3 years ago
7

Which of the following is a true statement about diffusion?

Biology
1 answer:
mafiozo [28]3 years ago
5 0
The correct statement is this one: Molecules move from areas of high concentration to areas of low concentration.

This is true also for diffusion outside of organisms, for example diffusion of gases in a room.

The other options are false.
<span />
You might be interested in
When a mouse eats grass only 10% of the energy from the plant is transferred to the mouse what happens to the other 90%
Mars2501 [29]
It’s possible the other 90% was excreted ? Because a lot of the energy may not be useful to the mouse’s system. ... hmmm. That’s all I could think of, sorry I can’t be a better help ;w;
3 0
3 years ago
Where do scientists obtain adult stem cells?<br> saliva<br> pancreas<br> skin<br> bone marrow
Alex17521 [72]
<span> Embryonic stem cell research is kind of a dead area now since there is no way to control the differentiation. Most research is being done on adult stem cells to help map and control the differentiation process.

Stem-cells from aborted fetuses - The government doesn't sponsor this, if it is done it is by private companies not located in the USA. You could try researching umbilical cord stem cells to be somewhere near your topic. They come from the afterbirth of normal deliveries.

You could do a much easier report by covering cloning of mice through stem-cell technology. It is happening and helping scientists understand diseases. </span>
6 0
3 years ago
Transport of materials into a cell against a concentration gradient, from low to high, requires A) water. B) energy. C) osmosis.
N76 [4]
The answer to this is B
5 0
3 years ago
Read 2 more answers
A new bacteria was introduced to the Antarctic ecosystem which dissolves the outer shells of crustaceans. What animal would be m
Leno4ka [110]

Answer:

it would be Fragilariopsis curta  because it is part of the diatom subspecies of algae and has a hard bone like silica shell making it more like a crustacean than a true algae

3 0
3 years ago
____________________ laundry trays do not provide a smooth, and sanitary surface, which is no longer permitted.
Alik [6]
The answer is concrete laundry trays.
This is because as concrete trays ages with timeit becomes coarse and rugged due to water, soap and detergents. Their smoothness gradually fades with time, thus this makes it not as good regarding to health wise standards of living.
5 0
3 years ago
Other questions:
  • A recognized means of inquiry to provide scientific answers to questions is
    9·1 answer
  • The presence of a y chromosome determines gender <br> True or False?
    8·2 answers
  • In Wisconsin, a very large population of lake trout, in which individuals mate at random, experiences no migration, mutations, n
    15·2 answers
  • Bacteria are examples
    9·1 answer
  • Where does The carbon , oxygen , and hydrogen to make glucose come from :
    8·2 answers
  • AGGUCAUGCAUGGGCAUGCAU tRNA sequence for the given strand of mRNA
    8·1 answer
  • 13: Mycobacteria are stained with
    7·1 answer
  • Write main four differences between chemical fertilizers and organic fertilizers
    11·1 answer
  • 3.2 Suggest the aim of the experiment of lime water ​
    8·1 answer
  • Is GMO is good or bad? And why? Can you please explain to me your answer so that i can understand, thanks!
    15·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!