1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Neporo4naja [7]
3 years ago
5

Does eating ice cause frequent urination

Biology
1 answer:
S_A_V [24]3 years ago
4 0
Yes. It does in fact.
                       Hop this helps.
if you have any other questions please contact me here on Brainly.com and I will be happy to help.
                                            -Diane
You might be interested in
What is the function of lateral meristem
Free_Kalibri [48]
Lateral meristem is responsible for the secondary growth of the plant.
7 0
3 years ago
What is one human activity that ma have caused the average temperature of the atmosphere to increase in recent years
KatRina [158]
Driveing, arsol, burning coal, not being able to stop wild fires quickly. Um ya
6 0
3 years ago
What is the name of the enzyme used to make rna nucleotides
Likurg_2 [28]
<h2>RNA Polymerase</h2>

Explanation:

  • RNA polymerase, a chemical in the cell, is  answerable for making mRNA from the  right quality. RNA polymerase is like  DNA polymerase, yet it makes a RNA strand  as opposed to a DNA strand. The promoter region of DNA Helix is attached by  RNA polymerase.
  • It pulls in nucleotides that supplement those  on the DNA strand containing the gene of interest. RNA polymerase duplicates one strand of  DNA to make a stretching bit of singlestranded  mRNA. RNA polymerase makes the  mRNA strand in what is known as the 5' to 3'  course.
8 0
3 years ago
What happens to the body when cirrhosis develops?
umka21 [38]
Cirrhosis of the liver is a disease that effects the function of the liver. the liver has a function to clean out and detoxify the body. If at that point the liver cannot clean out the toxins you either have dialysis to help clean out the toxins in the liver. it causes the kidneys not to function correctly and you may need a kidney transplant.
4 0
3 years ago
Read 2 more answers
A 3 base section of mRNA. The ribosome reads 1 codon at a time; translation of a new protein always begins with _________, or Me
lukranit [14]

Answer:

The start codon is AUG

Explanation:

A three nucleotide sequence (represented with bases) of a DNA or a RNA which translates to a specific amino acid is referred to as codon. To begin the translation into a new protein, the first three nucleotide is always AUG (called the START codon) which is the codon for methionine.

NOTE: AUG is the initial of the bases; Adenine, Uracil and Guanine

7 0
3 years ago
Other questions:
  • Why does the juxtaglomerular apparatus make you feel thirsty?
    8·1 answer
  • If both parents are carriers of the defective CF gene, what is the chance that their child will have cystic fibrosis?
    7·2 answers
  • What would be the complementary strand for the following DNA sequence 5' GACATACCCAGACGGTATATTGA 3'
    8·1 answer
  • Hialeah is a tornado-prone area in Florida.
    14·2 answers
  • How do you use a punnet square?
    13·1 answer
  • PLEASEEEE HELP!!!! 60 POINTS BRAINLIEST 5 STARS, THANKS!!!
    15·1 answer
  • SOMEONE I NEED HELP!!!!!!!!!!!!
    8·1 answer
  • Humans and other animals regulate cell growth and cell division. Sort these cells by category:
    10·2 answers
  • Identify the resources that cannot be replenished within the average span one
    12·1 answer
  • ʷʰᵃᵗ ᵈᵒ ᵘ ᵐᵉᵃⁿ ᵇʸ ʳᵉˢᵖⁱʳᵃᵗᵒʳʸ ˢʸˢᵗᵉᵐ ?<br><br>ˢᵖᵃᵐ ᵃⁿˢʷᵉʳ ʷⁱˡˡ ᵇᵉ ʳᵉᵖᵒʳᵗ .​
    13·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!