1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Murljashka [212]
3 years ago
11

1.During strenuous exercise, body temperature increases. The body responds to the increase in temperature by sweating, which hel

ps to reduce the body temperature. Which is demonstrated in this situation? A.Excretion B.Metabolism C.Homeostasis D.Synthesis
Biology
1 answer:
Anvisha [2.4K]3 years ago
3 0

Answer:homeostasis

Explanation:

You might be interested in
This diagram shows the menstrual cycle.
LiRa [457]

Answer:

According to the hormone diagram of the menstrual cycle, the woman is not pregnant due to the behavior of progesterone and estrogens, whose levels do not increase, in addition to the absence of human chorionic gonadotropin.

Explanation:

The graph shows the behavior of hormones during a woman's menstrual cycle in the absence of pregnancy.

During a woman's normal cycle, estrogen, luteinizing hormone (LH) and follicle stimulating hormone (FSH) tend to increase prior to ovulation, reach their peak values at ovulation, and then decline, as shown in the graph. Progesterone, on the other hand, increases after ovulation and decreases if the woman does not become pregnant.

In the case of a pregnant woman:

  • <u>Estrogens</u> continue to increase after ovulation, produced by the ovaries and placenta.
  • <u>Progesterone</u> also increases its levels, as it is a hormone produced by the ovaries and placenta.
  • <u>Hormone human chorionic gonadotropin</u> (HCG) appears and increases during pregnancy, due to the secretory activity of the placenta.

<em><u>The diagram represents the normal cycle of a woman who is not pregnant</u></em>.

4 0
3 years ago
Match each structure on the left with the corresponding function on the right. Group of answer choices Chemically digests food,
Ad libitum [116K]

Answer:

1. Chemically digests food, absorbs nutrients and minerals from food - Small intestine

2. Breaks down and physically digests food - Stomach

3. Metabolizes nutrients, detoxifies blood, makes bile - Liver

4. Stores and concentrates bile - Gallbladder

5. Removes waste products and excess fluid - Kidney

6. Filtering structure of kidney - Nephron

7. Produces eggs and reproductive hormones - Ovary

8. Produces sperm and reproductive hormone - Testis

Explanation:

This question is asking to correctly match certain digestive organs with their respective function. The organs and their function are as follows:

- Small intestine: Small intestine is the major organ that digests food chemically, and also absorbs nutrients and minerals from food.

- Stomach: This breaks down and physically digests food.

- Liver is responsible for metabolizing nutrients, detoxification of blood, and making of bile.

- Gall bladder is a greenish yellow organ responsible for the storage and concentration of the bile produced by the liver.

- Kidney is the major excretory organ of the body, which removes waste products and excess fluid from the body.

- Nephrons are numerous filtering structure of the kidney.

- Ovary is the female reproductive organ that produces the eggs/ova and other reproductive hormone like oestrogen.

- Testis is the male reproductive organ that produces the sperm and other reproductive hormone like testosterone etc.

7 0
3 years ago
What are some impacts of climate change on terrestrial ecosystems?
Ber [7]

Answer:

Climate change can overwhelm the capacity of ecosystems to mitigate extreme events and disturbance, such as wildfires, floods, and drought.

<em><u>-TheUnknownScientist</u></em>

5 0
2 years ago
Which best explains what exo in exoplanet means?
timofeeve [1]
Exo means outside


So planets outside our solar system
6 0
3 years ago
Name the quadrant(s) (RUQ, LUQ, RLQ, and LLQ) and region(s) (right hypochondriac, epigastric, left hypochondriac, right lumbar,
andreev551 [17]

Answer:Answer: 1) (a) The left lobe of the Liver is located in Left Upper Quadrant while the main part of the Liver is located in the Right Upper Quadrant.

(b) The liver is located in both the right hypochondriac region and the epigastric region

2) (a) The stomach is is located in the Left Upper Quadrant (LUQ)

(b) The stomach is majorly located in the epigastric region and the Left Hypochondriac Region.

3) (a)The Spleen is located at the Left Upper Quadrant (LUQ)

(b) The regions the Spleen are located at are the Left Hypochondriac Region, Epigastric Region and Left Lumbar

4) (a) The Gall Bladder is located at the Right Upper Quadrant

(b) The Gall Bladder is located at the Right Hypochondriac Region and the Right Lumbar Region.

5) (a)The Appendix is located in the Right Lower Quadrant

(b) The Appendix is located in the Right Iliac region.

6) (a) The Left kidney is located at the Left Upper Quadrant

(b) The left kidney cuts across the Left Hypochondriac Region, Right Lumbar and the Left Lumbar.

7) (a) The right Ovary is located at the Right Lower Quadrant

(b) The region of the right ovary is the hypogastric region.

8) (a) The Uterus is located at both the Right Lower Quadrant and Left Lower Quadrant.

(b) The Uterus is located in the hypogastric region of the abdomen.

Explanation: In medicine, the practitioners divide the lower part of the body known as the 'abdomen' with imaginary lines ( one vertical and one horizontal) to form the 'Quadrants' and (two vertical and two horizontal) the 'Regions'. The Quadrants are divided into four main parts:

1) Left Upper Quadrant (LUQ)

2) Right Upper Quadrant (RUQ)

3) Left Lower Quadrant (LLQ)

4) Right Lower Quadrant (RLQ)

The regions are divided into nine parts:

1) Left Hypochondriac Region

2) Right Hypochondriac Region

3) Epigastric Region

4) Left Lumbar Region

5) Right Lumbar Region

6) Umbilical Region

7) Right Iliac/Inguinal Region

8) Left Iliac/Inguinal Region

9) Hypogastric Region.

The abdomen is divided into regions in order to help medical practitioners and students easily understand the abdominal area of the body as well as the human anatomy. It also helps them provide preliminary diagnosis and treatment based on pain emanating from each region or quadrant.

6 0
3 years ago
Other questions:
  • Carbon’ can form four bonds, so it can create large complex molecules. Why is that?
    5·1 answer
  • The belief that genotype expression depends on environmental experience and how we respond to the environment depends on the gen
    7·1 answer
  • What is the difference between nitrification, denitrification, ammonification and nitrogen fixation?
    11·1 answer
  • How does producing plastics benefit the economy?
    15·2 answers
  • What would be the complementary strand for the following DNA sequence 5' GACATACCCAGACGGTATATTGA 3'
    8·1 answer
  • What are two disadvantages of GMO food?
    15·2 answers
  • In a sample of bacterial DNA, 14% of the nitrogenous bases are thymine. About what percentages are the other nitrogenous bases?
    12·1 answer
  • Choose all the answers that apply. Which of the following is a source of watershed pollution? pesticide fertilizer animal waste
    8·2 answers
  • PLEAe help mE ASAP ASAP
    11·2 answers
  • Is it possible to see the Milky Way from Earth or do we need satellites?
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!