Explanation:
Psi packaging Element is a cis-acting RNA element identified in the genomes of the retroviruses Human immunodeficiency virus (HIV) and Simian immunodeficiency virus (SIV) It is involved in regulating encapsidation of the retroviral RNA, an essential step in replication.
i think answer is D animal in the rain forest
<span>3’ tcgccctactcgcgtacaccgcgtattgac 5’ </span>turns into:
5' agcgggaugagcgcauguggcgauaacug 3'
adenine becomes uracil hope this helped :)
Answer
In the presence of oxygen two energy products are produced, these are:
1. ATP
2. NADH2
One NADH2 produce three ATP.
Conclusion:
so in the presence of oxygen the energy rich compound which is produced during glycolysis is NADH2.
1. Denatured
2. Catalyst
3. Specific
4. Cofactor
5. Complex
6. Active Site
7. Substrate
