1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
fenix001 [56]
2 years ago
11

What farming method is used in dry or desert areas?

Biology
2 answers:
nekit [7.7K]2 years ago
6 0

Answer:

B. Drip irrigation

Explanation:

qwelly [4]2 years ago
3 0

Answer: Option B

Explanation:

Desert farming is the practice of developing agriculture in deserts. Agriculture can be defined as the act of irrigation, water supply and farming.

The desert farming is different from the other types of farming and it has been practiced by the person living there.

These practices are to be used very precisely as the water is not available in a plenty amount. Taking into consideration drip irrigation is used in the desert and dry areas.

Drip irrigation can be defined as the modern method by which the micro-irrigation technique in which the water and the nutrients are saved and it allows the water to drip slowly into the roots of plants.

You might be interested in
Desmond is wearing a purple shirt to school. Which colors are being absorbed by the shirt to make it look purple? A purple, blue
vesna_86 [32]
Red, orange, yellow green and blue
8 0
2 years ago
8. Which type of skin cancer develops from melanocytes? A. Basal cell carcinoma B. Histamine C. Melanoma D. Squamous cell carcin
marissa [1.9K]
C... definitely MELANOMA
8 0
3 years ago
In Biology, what is a community?​
Deffense [45]

Answer:

A community is an interacting group of various species in a common location.

6 0
2 years ago
Read 2 more answers
When DNA is duplicated during mitosis:
Elena-2011 [213]
One completely new DNA molecule is formed it’s almost like having a baby
5 0
3 years ago
Which thick layer of the heart maintains its constant pulse?
aivan3 [116]

The myocardium is the thick, middle layer of the heart and is composed of cardiac muscle. Cardiac muscle is very unique because it possesses the characteristics of skeletal muscle AND smooth muscle. Skeletal muscle controls the voluntary movement of the body, while smooth muscle is responsible for the movement of all other body organs. The myocardium acts on its own, with no conscious effort.


5 0
3 years ago
Other questions:
  • Receptors that provide animals with information from the external environment are located in the _____.
    14·1 answer
  • What's the biology?​
    15·2 answers
  • What is lysozyme and where is it found in the respiratory system?
    14·1 answer
  • What is a condition in which the neuron membrane is more positive on the outside?
    14·1 answer
  • Which of the following is not an ideal location for a telescope?
    12·1 answer
  • Decode CCGCTTTCGCTATTATAAAAAGGGCTATAACTA
    14·1 answer
  • In 1980, a long dormant volcano, Mount St. Helens in Washington state, erupted violently. The eruption wiped out the forested la
    13·1 answer
  • Direction: Write IE (Industry Environment) if the statement describes Biotechnology in Industry and Environment and ND (Not disc
    11·1 answer
  • Why is acetylcholine broken down?
    5·1 answer
  • imagine that you could treat chloroplats with an indiicator dye that turns red in acidic conditions, yellow in neutral ocndition
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!