1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Anna007 [38]
2 years ago
14

Is there water in mars or in the moon

Biology
2 answers:
bogdanovich [222]2 years ago
7 0
No water has been discovered on either planet yet.
posledela2 years ago
7 0
No water on both so far
You might be interested in
Why do new species often form on new islands
Anon25 [30]

Answer:

The answer is B

Explanation:

New species often form on new islands because they evolve to fill new niches

5 0
2 years ago
Practicing three-point shots to improve free-throw accuracy contradicts the _________ principle of exercise.
vodomira [7]
Practicing three point shots to improve free throw accuracy contradicts the SPECIFICITY principle of exercise.
The specificity principle of exercise states that, to become an expert in a particular exercise or skill one should perform that exercise or skill. That is, the things that one do during physical activity should be relevant to one desired outcomes, thus, the training regimen must go from general to specific during training.
5 0
3 years ago
Read 2 more answers
Consider that RR is red (dominant) and WW is white (dominant) plant phenotypes. The offspring of a cross between an RR plant and
riadik2000 [5.3K]

Answer:

all pink

Explanation:

3 0
3 years ago
What major products are formed in alcohoilc fermentationi need the answer asap please
bearhunter [10]
Wine and alcohol beverages are the only things that i can think of  
5 0
2 years ago
Which concluding sentence best accomplishes arthurs goal of maintaning his current organization
Whitepunk [10]

Answer:

1

Explanation:

5 0
2 years ago
Other questions:
  • Electromagnetic energy released during fusion is converted to other kinds of photons as it is transferred through which layer of
    7·1 answer
  • How to wake up a snail when its deep inside its shell
    9·2 answers
  • If it is 2:20 and you add 43 minutes to it what time will it be
    13·2 answers
  • *will give brainliest!*<br><br> Why is the biosphere so fragile?
    12·2 answers
  • How do I use a codon wheel to solve this sequence of DNA?<br><br> AGTACCCGTTAATTAGTTGCCG
    5·1 answer
  • One way of balancing the concentration of ions and molecules within a cell is to use all but ______________ . ATP transfers one
    13·2 answers
  • Question 22 of 25
    7·1 answer
  • Can anyone answer one of my last few questions please?​
    5·2 answers
  • How is the DNA in your skin cells related to the DNA in your heart, liver, and lung cells?
    9·1 answer
  • Please help! Will mark brainlisttt !!!!
    9·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!