1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
andrezito [222]
2 years ago
7

Kevin plans to put concrete on a rectangular portion of his driveway the portion is 10 feet long and 3 inches high the price of

concrete is 98$ per cubic yard the total cost of the concrete Kevin needs is 72.59$ which of the following is closest to the width of the portion of the driveway on which Kevin plans to put concrete
Mathematics
1 answer:
Fudgin [204]2 years ago
5 0
First we need to know the total volume of concrete used:
V_total = \frac{cost_{total}}{cost{unit}}
V_total = \frac{\$72.98}{\frac{\$90}{yd^{3}}}
V_total = 0.7407yd^{3}

Now we can use the formula for volume of a rectangular prism:
V=lwh
Convert everythig to yards and substitute: 
0.7407yd^{3}=(3.33yd)(w)(0.08333yd)
w=\frac{0.7407}{3.33 \times 0.08333}
w \aprox 2.66yd
You might be interested in
At which values of x does the function F(X) have a vertical asymptote? F(X) =3/x(x-5)(x+1)
damaskus [11]

Answer:

There are vertical asymptotes at x:  {-1, 0, 5}

Step-by-step explanation:

It's easier (at least for some) if you write this function as

                  3

F(X) = ------------------

            x(x-5)(x+1)

Can you now see that if x = 0, this function is undefined?  Same for x = 5 and x = -1?  There are vertical asymptotes at x:  {-1, 0, 5}

5 0
3 years ago
En un hotel hay 67 habitaciones entre dobles y sencillas, si el número de camas es 92. ¿Cuántas habitaciones hay de cada tipo?​
Alina [70]

Answer:

25 dobles y 42 sencillas

Step-by-step explanation:

25 x 2 = 50 camas + 42 = 92

y 25 habitaciones dobles + 42 sencillas = 67

7 0
3 years ago
A bin contains 64 light bulbs of which 10 are defective. if 5 light bulbs are randomly selected from the bin with replacement, f
Sloan [31]
Total number of bulbs = 64
Number of defective bulbs = 10
Number of good bulbs = 64 - 10 = 54

P(5 good bulbs) = (54/64)⁵ = (27/32)⁵ = 0.428


Answer: 0.428
3 0
3 years ago
Sandy had 219 football cards. She bought 57 more at a garage sale. How many did she have then?
8_murik_8 [283]
Therefore, Sandy has 276 football cards.
5 0
3 years ago
Read 2 more answers
I don’t understand how to do this
Simora [160]
It's looking for the measures

m<F + m<G = 180°

(4x)° + (8x)° = 180°

12x = 180°
÷12 ÷12


x = 15

check your work

m<F + m<G = 180°

(4x)° + (8x)° = 180°

4(15)° + 8(15)° = 180°

60° + 120° = 180°
3 0
3 years ago
Other questions:
  • Which statement best describes the function f (x)=2x^2-3x+1
    6·1 answer
  • the midpoint of PQ is R. R has coordinates (-3,2,-1) and P has coordinates (4,-6,-6). What are coordinates of Q?
    14·1 answer
  • Give an algebraic example of the Transitive Property.
    8·1 answer
  • Find the quotient and remainder for 52÷8
    12·1 answer
  • What is the sum of a 7-term geometric series if the first term is 6, the last term is 24,576, and the common ratio is −4?
    10·2 answers
  • What is 0.303 as a fraction ?
    15·2 answers
  • Find two numbers between 100 and 150 that have a GCF of 24.
    11·1 answer
  • What is the complementary DNA strand for the DNA strand<br> AATTGGCCATGCATGATTACGA
    7·2 answers
  • 6h²-3g³+7+3f²+9g³-5h²-2f²-9
    9·1 answer
  • Please help me with my math please.?
    7·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!